FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637634_at:

>probe:Drosophila_2:1637634_at:136:635; Interrogation_Position=429; Antisense; TCCCAGCTCCGGCTCCAATTGAGAT
>probe:Drosophila_2:1637634_at:238:337; Interrogation_Position=434; Antisense; GCTCCGGCTCCAATTGAGATCCCTG
>probe:Drosophila_2:1637634_at:300:37; Interrogation_Position=493; Antisense; ACCAGCACCAGCTCCGGTTTACCAG
>probe:Drosophila_2:1637634_at:230:11; Interrogation_Position=533; Antisense; ATTCCCGTGAGCATCCCGGCTCCAG
>probe:Drosophila_2:1637634_at:300:301; Interrogation_Position=661; Antisense; CCCAGCTCCCGTTAAGTCCTATGTG
>probe:Drosophila_2:1637634_at:134:117; Interrogation_Position=664; Antisense; AGCTCCCGTTAAGTCCTATGTGCCA
>probe:Drosophila_2:1637634_at:460:471; Interrogation_Position=671; Antisense; GTTAAGTCCTATGTGCCACCTGCAC
>probe:Drosophila_2:1637634_at:214:61; Interrogation_Position=681; Antisense; ATGTGCCACCTGCACCAATCAGCAT
>probe:Drosophila_2:1637634_at:123:127; Interrogation_Position=795; Antisense; AGCCAACCAACACTCAGGTTCTGGA
>probe:Drosophila_2:1637634_at:127:311; Interrogation_Position=801; Antisense; CCAACACTCAGGTTCTGGAGGAGAT
>probe:Drosophila_2:1637634_at:207:125; Interrogation_Position=828; Antisense; AGCCCGCTTCCAATGATGGATACCG
>probe:Drosophila_2:1637634_at:559:211; Interrogation_Position=857; Antisense; AAGACCGTGCGTCGTCGCGTCTACC
>probe:Drosophila_2:1637634_at:243:633; Interrogation_Position=871; Antisense; TCGCGTCTACCGTCACCGTTTCTAA
>probe:Drosophila_2:1637634_at:625:647; Interrogation_Position=927; Antisense; TAACGAATCCCTACGGGGACTCGCA

Paste this into a BLAST search page for me
TCCCAGCTCCGGCTCCAATTGAGATGCTCCGGCTCCAATTGAGATCCCTGACCAGCACCAGCTCCGGTTTACCAGATTCCCGTGAGCATCCCGGCTCCAGCCCAGCTCCCGTTAAGTCCTATGTGAGCTCCCGTTAAGTCCTATGTGCCAGTTAAGTCCTATGTGCCACCTGCACATGTGCCACCTGCACCAATCAGCATAGCCAACCAACACTCAGGTTCTGGACCAACACTCAGGTTCTGGAGGAGATAGCCCGCTTCCAATGATGGATACCGAAGACCGTGCGTCGTCGCGTCTACCTCGCGTCTACCGTCACCGTTTCTAATAACGAATCCCTACGGGGACTCGCA

Full Affymetrix probeset data:

Annotations for 1637634_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720