FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637635_at:

>probe:Drosophila_2:1637635_at:406:97; Interrogation_Position=2102; Antisense; AGATGCGAGATAAGTCCACTCCCCA
>probe:Drosophila_2:1637635_at:535:427; Interrogation_Position=2170; Antisense; GAGATATATATCTGCCCATCCAAGC
>probe:Drosophila_2:1637635_at:231:629; Interrogation_Position=2197; Antisense; TCCGGCTAAGCCTCGAATATTGTTT
>probe:Drosophila_2:1637635_at:209:157; Interrogation_Position=2249; Antisense; ACACATCCTTTGTTTGGCCGGCGAA
>probe:Drosophila_2:1637635_at:694:385; Interrogation_Position=2271; Antisense; GAACAATGGACTCGCCGGTTCGCAA
>probe:Drosophila_2:1637635_at:121:173; Interrogation_Position=2333; Antisense; AAAGAGCATTTGTCCAGGCGGCTCC
>probe:Drosophila_2:1637635_at:294:1; Interrogation_Position=2348; Antisense; AGGCGGCTCCTTTTACACGGTGGCT
>probe:Drosophila_2:1637635_at:417:139; Interrogation_Position=2364; Antisense; ACGGTGGCTATACACACTCGACGTA
>probe:Drosophila_2:1637635_at:512:289; Interrogation_Position=2382; Antisense; CGACGTATACGATTGTTTCACAGTT
>probe:Drosophila_2:1637635_at:649:697; Interrogation_Position=2397; Antisense; TTTCACAGTTCGCAGATCCTAGATC
>probe:Drosophila_2:1637635_at:725:463; Interrogation_Position=2488; Antisense; GATTCCATTGATCGTTCCAAGTCCA
>probe:Drosophila_2:1637635_at:34:295; Interrogation_Position=2565; Antisense; CGATGTCTATTATGCGATGCCTAAC
>probe:Drosophila_2:1637635_at:407:447; Interrogation_Position=2580; Antisense; GATGCCTAACATTTACCACGATTAT
>probe:Drosophila_2:1637635_at:663:247; Interrogation_Position=2596; Antisense; CACGATTATCCGCAGTTTGTTTTAA

Paste this into a BLAST search page for me
AGATGCGAGATAAGTCCACTCCCCAGAGATATATATCTGCCCATCCAAGCTCCGGCTAAGCCTCGAATATTGTTTACACATCCTTTGTTTGGCCGGCGAAGAACAATGGACTCGCCGGTTCGCAAAAAGAGCATTTGTCCAGGCGGCTCCAGGCGGCTCCTTTTACACGGTGGCTACGGTGGCTATACACACTCGACGTACGACGTATACGATTGTTTCACAGTTTTTCACAGTTCGCAGATCCTAGATCGATTCCATTGATCGTTCCAAGTCCACGATGTCTATTATGCGATGCCTAACGATGCCTAACATTTACCACGATTATCACGATTATCCGCAGTTTGTTTTAA

Full Affymetrix probeset data:

Annotations for 1637635_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720