FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637636_at:

>probe:Drosophila_2:1637636_at:157:55; Interrogation_Position=1914; Antisense; ATGACGCACATTTGCATGCTGGACT
>probe:Drosophila_2:1637636_at:184:327; Interrogation_Position=1971; Antisense; GCGATATTAGTCTTAGGTCCCAGCC
>probe:Drosophila_2:1637636_at:631:261; Interrogation_Position=1991; Antisense; CAGCCTCATTTCAATCGTACACAAC
>probe:Drosophila_2:1637636_at:59:293; Interrogation_Position=2040; Antisense; CGTAAGATTAGGTCCGGCGAGCCGA
>probe:Drosophila_2:1637636_at:193:365; Interrogation_Position=2076; Antisense; GAATATGCAACTGCTCTGGCTGAAA
>probe:Drosophila_2:1637636_at:431:15; Interrogation_Position=2135; Antisense; ATTAGTCTTTGCATTCTGGGTGTCC
>probe:Drosophila_2:1637636_at:484:269; Interrogation_Position=2167; Antisense; CATGGATTCTGTTGCGTCTGTACGA
>probe:Drosophila_2:1637636_at:563:535; Interrogation_Position=2195; Antisense; GGTCACGGGCGATGTTATCCAAAGT
>probe:Drosophila_2:1637636_at:683:165; Interrogation_Position=2215; Antisense; AAAGTACTCTTATCAACTTCGCCGT
>probe:Drosophila_2:1637636_at:73:293; Interrogation_Position=2237; Antisense; CGTCGTCTGGATCGGCATATTGAAT
>probe:Drosophila_2:1637636_at:478:453; Interrogation_Position=2279; Antisense; GATCATGACCAGTATGTCGCCGCAA
>probe:Drosophila_2:1637636_at:524:297; Interrogation_Position=2299; Antisense; CGCAATTCCGTATCGCTTTGAGAGT
>probe:Drosophila_2:1637636_at:454:143; Interrogation_Position=2349; Antisense; ACTAAGGGCCGTTTGCAAGCAGAGC
>probe:Drosophila_2:1637636_at:410:205; Interrogation_Position=2365; Antisense; AAGCAGAGCTAATCGGGTTGGACCC

Paste this into a BLAST search page for me
ATGACGCACATTTGCATGCTGGACTGCGATATTAGTCTTAGGTCCCAGCCCAGCCTCATTTCAATCGTACACAACCGTAAGATTAGGTCCGGCGAGCCGAGAATATGCAACTGCTCTGGCTGAAAATTAGTCTTTGCATTCTGGGTGTCCCATGGATTCTGTTGCGTCTGTACGAGGTCACGGGCGATGTTATCCAAAGTAAAGTACTCTTATCAACTTCGCCGTCGTCGTCTGGATCGGCATATTGAATGATCATGACCAGTATGTCGCCGCAACGCAATTCCGTATCGCTTTGAGAGTACTAAGGGCCGTTTGCAAGCAGAGCAAGCAGAGCTAATCGGGTTGGACCC

Full Affymetrix probeset data:

Annotations for 1637636_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720