Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637637_at:

>probe:Drosophila_2:1637637_at:335:673; Interrogation_Position=2540; Antisense; TACCATCCCGTGTGTCCGGAGCTGT
>probe:Drosophila_2:1637637_at:678:321; Interrogation_Position=2570; Antisense; GCGCCATTGTCCAGCAATCGGGAGC
>probe:Drosophila_2:1637637_at:122:237; Interrogation_Position=2585; Antisense; AATCGGGAGCCAATCGCTATGTGCC
>probe:Drosophila_2:1637637_at:103:251; Interrogation_Position=2595; Antisense; CAATCGCTATGTGCCGGAGAGTATG
>probe:Drosophila_2:1637637_at:108:101; Interrogation_Position=2612; Antisense; AGAGTATGCGTGGACAGGTGAACCA
>probe:Drosophila_2:1637637_at:715:249; Interrogation_Position=2658; Antisense; CAATGAGTTGTCCAATGCCTTCAGT
>probe:Drosophila_2:1637637_at:717:49; Interrogation_Position=2672; Antisense; ATGCCTTCAGTTCGCGATTCAAGTA
>probe:Drosophila_2:1637637_at:525:325; Interrogation_Position=2685; Antisense; GCGATTCAAGTAATGGCCGCGTAAT
>probe:Drosophila_2:1637637_at:625:577; Interrogation_Position=2699; Antisense; GGCCGCGTAATTGAGTGCACAGCAT
>probe:Drosophila_2:1637637_at:271:357; Interrogation_Position=2715; Antisense; GCACAGCATGCCAGAGTATGCTTAA
>probe:Drosophila_2:1637637_at:178:391; Interrogation_Position=2755; Antisense; GAAACTTAGAGAGCCAGCACGCGAA
>probe:Drosophila_2:1637637_at:463:309; Interrogation_Position=2790; Antisense; CCACCAACCATATCACATCATTTTT
>probe:Drosophila_2:1637637_at:420:363; Interrogation_Position=2848; Antisense; GCAATTCCCATCCAGTTGTTTCGAA
>probe:Drosophila_2:1637637_at:11:513; Interrogation_Position=2896; Antisense; GTGTTTTACACATGATCTTTTGGAC

Paste this into a BLAST search page for me
TACCATCCCGTGTGTCCGGAGCTGTGCGCCATTGTCCAGCAATCGGGAGCAATCGGGAGCCAATCGCTATGTGCCCAATCGCTATGTGCCGGAGAGTATGAGAGTATGCGTGGACAGGTGAACCACAATGAGTTGTCCAATGCCTTCAGTATGCCTTCAGTTCGCGATTCAAGTAGCGATTCAAGTAATGGCCGCGTAATGGCCGCGTAATTGAGTGCACAGCATGCACAGCATGCCAGAGTATGCTTAAGAAACTTAGAGAGCCAGCACGCGAACCACCAACCATATCACATCATTTTTGCAATTCCCATCCAGTTGTTTCGAAGTGTTTTACACATGATCTTTTGGAC

Full Affymetrix probeset data:

Annotations for 1637637_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime