Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637639_at:

>probe:Drosophila_2:1637639_at:149:671; Interrogation_Position=1021; Antisense; TACGGCGTGGGATCGAGCAATGCTA
>probe:Drosophila_2:1637639_at:121:421; Interrogation_Position=1035; Antisense; GAGCAATGCTACTTACCCATCGGCT
>probe:Drosophila_2:1637639_at:203:419; Interrogation_Position=1096; Antisense; GAGCAGCTGAGATCCCAGTTTGCAT
>probe:Drosophila_2:1637639_at:253:397; Interrogation_Position=1159; Antisense; GACAGCTACAACTTTGCGGGTTCCT
>probe:Drosophila_2:1637639_at:342:73; Interrogation_Position=1206; Antisense; AGGCAACCATATTAGCGGCTACCAT
>probe:Drosophila_2:1637639_at:56:333; Interrogation_Position=1220; Antisense; GCGGCTACCATCATCAGGTTGATCA
>probe:Drosophila_2:1637639_at:262:419; Interrogation_Position=1248; Antisense; GAGCTCAATGATGACCACTGCACCA
>probe:Drosophila_2:1637639_at:657:217; Interrogation_Position=701; Antisense; AAGTTTGGTTCTCTAATCGCCGTGC
>probe:Drosophila_2:1637639_at:224:151; Interrogation_Position=775; Antisense; ACATCTACTTCTTTTGGCGCAACTC
>probe:Drosophila_2:1637639_at:612:511; Interrogation_Position=831; Antisense; GGGAATGAGCCTTTACAGTTCACAG
>probe:Drosophila_2:1637639_at:484:667; Interrogation_Position=844; Antisense; TACAGTTCACAGAGCTGGCCATCAT
>probe:Drosophila_2:1637639_at:321:579; Interrogation_Position=860; Antisense; GGCCATCATCCGGAGCCTATGAAAA
>probe:Drosophila_2:1637639_at:243:37; Interrogation_Position=884; Antisense; ATCATGCTGCCTATGGTGGATCGGT
>probe:Drosophila_2:1637639_at:551:373; Interrogation_Position=998; Antisense; GAAGCGAGTTTATGACCTCCACTTA

Paste this into a BLAST search page for me
TACGGCGTGGGATCGAGCAATGCTAGAGCAATGCTACTTACCCATCGGCTGAGCAGCTGAGATCCCAGTTTGCATGACAGCTACAACTTTGCGGGTTCCTAGGCAACCATATTAGCGGCTACCATGCGGCTACCATCATCAGGTTGATCAGAGCTCAATGATGACCACTGCACCAAAGTTTGGTTCTCTAATCGCCGTGCACATCTACTTCTTTTGGCGCAACTCGGGAATGAGCCTTTACAGTTCACAGTACAGTTCACAGAGCTGGCCATCATGGCCATCATCCGGAGCCTATGAAAAATCATGCTGCCTATGGTGGATCGGTGAAGCGAGTTTATGACCTCCACTTA

Full Affymetrix probeset data:

Annotations for 1637639_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime