FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637640_at:

>probe:Drosophila_2:1637640_at:391:583; Interrogation_Position=1006; Antisense; TGGTTCCTGGTTTTTTGGGAGCCAT
>probe:Drosophila_2:1637640_at:378:315; Interrogation_Position=1034; Antisense; GCCTCCGACAAAGACACCGTGTTAT
>probe:Drosophila_2:1637640_at:395:565; Interrogation_Position=1077; Antisense; GGAATCAAGGCGCAGATCTCACGAT
>probe:Drosophila_2:1637640_at:506:451; Interrogation_Position=1091; Antisense; GATCTCACGATTTGCACGATACCAT
>probe:Drosophila_2:1637640_at:635:375; Interrogation_Position=1219; Antisense; GAAGCACGTCTATTAAACGCCTTTG
>probe:Drosophila_2:1637640_at:22:201; Interrogation_Position=1234; Antisense; AACGCCTTTGAAAGCACCCAGGAAT
>probe:Drosophila_2:1637640_at:116:363; Interrogation_Position=1255; Antisense; GAATTTAAGTCATGCGCCACGTGGT
>probe:Drosophila_2:1637640_at:42:301; Interrogation_Position=1269; Antisense; CGCCACGTGGTTTAATTCTCGACTA
>probe:Drosophila_2:1637640_at:291:713; Interrogation_Position=1284; Antisense; TTCTCGACTAAACTGGTATGCTCTA
>probe:Drosophila_2:1637640_at:258:349; Interrogation_Position=1346; Antisense; GCAGGTGCCTCAGTTGTTTTACAGT
>probe:Drosophila_2:1637640_at:694:499; Interrogation_Position=1382; Antisense; GTCGATGTTGTACCCTGTGCAATAA
>probe:Drosophila_2:1637640_at:139:25; Interrogation_Position=875; Antisense; ATATGCTACGAGATCTGGTTCAGGC
>probe:Drosophila_2:1637640_at:667:649; Interrogation_Position=930; Antisense; TCAAAGGTGTCTACCGATCCCAGGG
>probe:Drosophila_2:1637640_at:233:7; Interrogation_Position=987; Antisense; ATTGCTATATTTGCTGGCCTGGTTC

Paste this into a BLAST search page for me
TGGTTCCTGGTTTTTTGGGAGCCATGCCTCCGACAAAGACACCGTGTTATGGAATCAAGGCGCAGATCTCACGATGATCTCACGATTTGCACGATACCATGAAGCACGTCTATTAAACGCCTTTGAACGCCTTTGAAAGCACCCAGGAATGAATTTAAGTCATGCGCCACGTGGTCGCCACGTGGTTTAATTCTCGACTATTCTCGACTAAACTGGTATGCTCTAGCAGGTGCCTCAGTTGTTTTACAGTGTCGATGTTGTACCCTGTGCAATAAATATGCTACGAGATCTGGTTCAGGCTCAAAGGTGTCTACCGATCCCAGGGATTGCTATATTTGCTGGCCTGGTTC

Full Affymetrix probeset data:

Annotations for 1637640_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720