FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637641_at:

>probe:Drosophila_2:1637641_at:47:31; Interrogation_Position=1483; Antisense; ATAAATATATTGAAGCCGAAGCGAA
>probe:Drosophila_2:1637641_at:97:141; Interrogation_Position=1521; Antisense; ACTGAGAGCAGTTTTCTAGGTATAT
>probe:Drosophila_2:1637641_at:446:661; Interrogation_Position=1597; Antisense; TAAAGTTTGTTATATTCGGAGCGAT
>probe:Drosophila_2:1637641_at:603:21; Interrogation_Position=1608; Antisense; ATATTCGGAGCGATTGGCCGCGATA
>probe:Drosophila_2:1637641_at:272:297; Interrogation_Position=1626; Antisense; CGCGATAGGCGCTCCCTAATATAAA
>probe:Drosophila_2:1637641_at:91:243; Interrogation_Position=1649; Antisense; AATATACTACCATGCCAAGTCATAT
>probe:Drosophila_2:1637641_at:309:509; Interrogation_Position=1683; Antisense; GTGAACTAAAATCCCGAATATCGAA
>probe:Drosophila_2:1637641_at:368:39; Interrogation_Position=1855; Antisense; ATCGGCATAGACCATATAGCTAAGC
>probe:Drosophila_2:1637641_at:245:659; Interrogation_Position=1875; Antisense; TAAGCAGATTTTAGCAAGGTTTGAC
>probe:Drosophila_2:1637641_at:328:359; Interrogation_Position=1888; Antisense; GCAAGGTTTGACAATTGGTCTAGAT
>probe:Drosophila_2:1637641_at:690:315; Interrogation_Position=1923; Antisense; GCCGATTAATCGCATAAAGTTATTT
>probe:Drosophila_2:1637641_at:392:475; Interrogation_Position=1941; Antisense; GTTATTTTCTACAAACGACATGTTA
>probe:Drosophila_2:1637641_at:509:171; Interrogation_Position=2034; Antisense; AAAGTTGTATGCGTGTCAGCTGTTT
>probe:Drosophila_2:1637641_at:152:683; Interrogation_Position=2041; Antisense; TATGCGTGTCAGCTGTTTTCCAGTC

Paste this into a BLAST search page for me
ATAAATATATTGAAGCCGAAGCGAAACTGAGAGCAGTTTTCTAGGTATATTAAAGTTTGTTATATTCGGAGCGATATATTCGGAGCGATTGGCCGCGATACGCGATAGGCGCTCCCTAATATAAAAATATACTACCATGCCAAGTCATATGTGAACTAAAATCCCGAATATCGAAATCGGCATAGACCATATAGCTAAGCTAAGCAGATTTTAGCAAGGTTTGACGCAAGGTTTGACAATTGGTCTAGATGCCGATTAATCGCATAAAGTTATTTGTTATTTTCTACAAACGACATGTTAAAAGTTGTATGCGTGTCAGCTGTTTTATGCGTGTCAGCTGTTTTCCAGTC

Full Affymetrix probeset data:

Annotations for 1637641_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720