FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637642_at:

>probe:Drosophila_2:1637642_at:392:575; Interrogation_Position=183; Antisense; GGCGCTGGCCCAGAGTAACAACAAC
>probe:Drosophila_2:1637642_at:540:661; Interrogation_Position=198; Antisense; TAACAACAACGTGCAGCGGGCGGTG
>probe:Drosophila_2:1637642_at:5:111; Interrogation_Position=26; Antisense; AGCAATTGCATCTGAAATCTCCGCC
>probe:Drosophila_2:1637642_at:600:169; Interrogation_Position=263; Antisense; AAAGGCGTGGCAATCGCAAGCGATT
>probe:Drosophila_2:1637642_at:701:461; Interrogation_Position=284; Antisense; GATTAAGGCAACTGCGCAGCTCCCT
>probe:Drosophila_2:1637642_at:358:527; Interrogation_Position=313; Antisense; GGGAATCCACTTGCCACGGATGAAG
>probe:Drosophila_2:1637642_at:626:35; Interrogation_Position=359; Antisense; ATCAGAGGATCGCACAGACGCTCGC
>probe:Drosophila_2:1637642_at:87:265; Interrogation_Position=373; Antisense; CAGACGCTCGCCGAGTTGGTGAACG
>probe:Drosophila_2:1637642_at:179:353; Interrogation_Position=398; Antisense; GCAGCAGTGTGCAGGCCATGGAACT
>probe:Drosophila_2:1637642_at:496:165; Interrogation_Position=40; Antisense; AAATCTCCGCCAGAAACGGCTGCAG
>probe:Drosophila_2:1637642_at:226:585; Interrogation_Position=416; Antisense; TGGAACTGCTACTGTCCGAGGAAGT
>probe:Drosophila_2:1637642_at:376:115; Interrogation_Position=470; Antisense; AGCAGGAGCTTGAAACCAGCCAGGA
>probe:Drosophila_2:1637642_at:17:127; Interrogation_Position=487; Antisense; AGCCAGGAGCAGTCATCCTCATCTG
>probe:Drosophila_2:1637642_at:91:553; Interrogation_Position=67; Antisense; GGAGCAGGATCTCCTCAAGCAGCCG

Paste this into a BLAST search page for me
GGCGCTGGCCCAGAGTAACAACAACTAACAACAACGTGCAGCGGGCGGTGAGCAATTGCATCTGAAATCTCCGCCAAAGGCGTGGCAATCGCAAGCGATTGATTAAGGCAACTGCGCAGCTCCCTGGGAATCCACTTGCCACGGATGAAGATCAGAGGATCGCACAGACGCTCGCCAGACGCTCGCCGAGTTGGTGAACGGCAGCAGTGTGCAGGCCATGGAACTAAATCTCCGCCAGAAACGGCTGCAGTGGAACTGCTACTGTCCGAGGAAGTAGCAGGAGCTTGAAACCAGCCAGGAAGCCAGGAGCAGTCATCCTCATCTGGGAGCAGGATCTCCTCAAGCAGCCG

Full Affymetrix probeset data:

Annotations for 1637642_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720