FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637643_at:

>probe:Drosophila_2:1637643_at:653:149; Interrogation_Position=1028; Antisense; ACATAGGCGATTCTTCTCCGGGAGC
>probe:Drosophila_2:1637643_at:473:281; Interrogation_Position=1043; Antisense; CTCCGGGAGCATCACTCTTTGAGAA
>probe:Drosophila_2:1637643_at:485:471; Interrogation_Position=1068; Antisense; GTTCGAGTGTGCAGTGTGCTACCAT
>probe:Drosophila_2:1637643_at:153:511; Interrogation_Position=1114; Antisense; GTGAAGGCCGACTTGCGTCATTACA
>probe:Drosophila_2:1637643_at:372:329; Interrogation_Position=1128; Antisense; GCGTCATTACAATTGTCCCCTGGAA
>probe:Drosophila_2:1637643_at:229:303; Interrogation_Position=1144; Antisense; CCCCTGGAACCGGTGTATGCTAAGA
>probe:Drosophila_2:1637643_at:109:675; Interrogation_Position=1223; Antisense; TAGGCCAGTGCCAAGCTAAGGTACT
>probe:Drosophila_2:1637643_at:631:637; Interrogation_Position=1247; Antisense; TCGATGAGTTCTTCCGTCGAGACAT
>probe:Drosophila_2:1637643_at:443:247; Interrogation_Position=755; Antisense; AATTGCTGCGTTTCCTGTCCGAATA
>probe:Drosophila_2:1637643_at:558:603; Interrogation_Position=788; Antisense; TGATTGCCATTGAGAACGCTGCCTG
>probe:Drosophila_2:1637643_at:170:201; Interrogation_Position=802; Antisense; AACGCTGCCTGTCCGGATTATATTA
>probe:Drosophila_2:1637643_at:467:583; Interrogation_Position=876; Antisense; TGGCTCACCCACCATAAAAGCATTG
>probe:Drosophila_2:1637643_at:206:715; Interrogation_Position=945; Antisense; TTCGTACCGCCAACACAAACTAAAT
>probe:Drosophila_2:1637643_at:697:179; Interrogation_Position=991; Antisense; AAAAAGCTACTCCACAACCTTGTCA

Paste this into a BLAST search page for me
ACATAGGCGATTCTTCTCCGGGAGCCTCCGGGAGCATCACTCTTTGAGAAGTTCGAGTGTGCAGTGTGCTACCATGTGAAGGCCGACTTGCGTCATTACAGCGTCATTACAATTGTCCCCTGGAACCCCTGGAACCGGTGTATGCTAAGATAGGCCAGTGCCAAGCTAAGGTACTTCGATGAGTTCTTCCGTCGAGACATAATTGCTGCGTTTCCTGTCCGAATATGATTGCCATTGAGAACGCTGCCTGAACGCTGCCTGTCCGGATTATATTATGGCTCACCCACCATAAAAGCATTGTTCGTACCGCCAACACAAACTAAATAAAAAGCTACTCCACAACCTTGTCA

Full Affymetrix probeset data:

Annotations for 1637643_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720