FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637644_at:

>probe:Drosophila_2:1637644_at:525:353; Interrogation_Position=1001; Antisense; GCAGCGTCTTCAATCGGCAATTGCA
>probe:Drosophila_2:1637644_at:536:171; Interrogation_Position=1025; Antisense; AACAGTACGGCGTTTACGGCTTGAT
>probe:Drosophila_2:1637644_at:195:227; Interrogation_Position=1050; Antisense; AATGGGAGCATTTTCGCTACCCTTT
>probe:Drosophila_2:1637644_at:183:685; Interrogation_Position=1104; Antisense; TATCGATACTGTTTCCGAGGCCATC
>probe:Drosophila_2:1637644_at:666:439; Interrogation_Position=1120; Antisense; GAGGCCATCCAAAGTATTTCGACAT
>probe:Drosophila_2:1637644_at:464:361; Interrogation_Position=1180; Antisense; GAATACGAAATGCTCAACGCCCGGA
>probe:Drosophila_2:1637644_at:582:123; Interrogation_Position=1271; Antisense; AGCCGCTGTTCAAAATGGACTCCGA
>probe:Drosophila_2:1637644_at:9:271; Interrogation_Position=733; Antisense; CATGCTGTTATCTGTCACGGTGACT
>probe:Drosophila_2:1637644_at:480:415; Interrogation_Position=787; Antisense; GAGCCTAATTCTGATCAACCTGTGG
>probe:Drosophila_2:1637644_at:189:549; Interrogation_Position=810; Antisense; GGAGGCCAAGCTGATCGACTTTCAA
>probe:Drosophila_2:1637644_at:152:149; Interrogation_Position=827; Antisense; ACTTTCAAATGTCTCGCTATGCACC
>probe:Drosophila_2:1637644_at:681:705; Interrogation_Position=873; Antisense; TTACCTGTTTGCCTGCACGGAGAAA
>probe:Drosophila_2:1637644_at:116:149; Interrogation_Position=914; Antisense; ACTTCCCCGACTTTATGGATGCTTA
>probe:Drosophila_2:1637644_at:610:637; Interrogation_Position=983; Antisense; TCGAGGGCATATATCCGCGCAGCGT

Paste this into a BLAST search page for me
GCAGCGTCTTCAATCGGCAATTGCAAACAGTACGGCGTTTACGGCTTGATAATGGGAGCATTTTCGCTACCCTTTTATCGATACTGTTTCCGAGGCCATCGAGGCCATCCAAAGTATTTCGACATGAATACGAAATGCTCAACGCCCGGAAGCCGCTGTTCAAAATGGACTCCGACATGCTGTTATCTGTCACGGTGACTGAGCCTAATTCTGATCAACCTGTGGGGAGGCCAAGCTGATCGACTTTCAAACTTTCAAATGTCTCGCTATGCACCTTACCTGTTTGCCTGCACGGAGAAAACTTCCCCGACTTTATGGATGCTTATCGAGGGCATATATCCGCGCAGCGT

Full Affymetrix probeset data:

Annotations for 1637644_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720