FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637645_at:

>probe:Drosophila_2:1637645_at:83:327; Interrogation_Position=1077; Antisense; GCGATTTTTAAATGCTAGCCCGTAC
>probe:Drosophila_2:1637645_at:134:415; Interrogation_Position=1092; Antisense; TAGCCCGTACGGACTACTTGAACAA
>probe:Drosophila_2:1637645_at:235:109; Interrogation_Position=1123; Antisense; AGAATTGGCCTTCTTAGGGCTAAAT
>probe:Drosophila_2:1637645_at:130:353; Interrogation_Position=575; Antisense; GCAGCAGCGAGGACATAGCCAACAT
>probe:Drosophila_2:1637645_at:382:75; Interrogation_Position=617; Antisense; AGGGCCTAAGGCAGCGACTCCAGAG
>probe:Drosophila_2:1637645_at:650:65; Interrogation_Position=643; Antisense; ATGGATCGACTTGCCGATACGCAAA
>probe:Drosophila_2:1637645_at:22:457; Interrogation_Position=658; Antisense; GATACGCAAAGAGCGCTTGGTCCAA
>probe:Drosophila_2:1637645_at:128:325; Interrogation_Position=670; Antisense; GCGCTTGGTCCAATTGTGATCACAA
>probe:Drosophila_2:1637645_at:666:159; Interrogation_Position=691; Antisense; ACAAGACCAACATGCGTTCACGAGT
>probe:Drosophila_2:1637645_at:637:643; Interrogation_Position=708; Antisense; TCACGAGTCCTGTCCCTAAGGAAAG
>probe:Drosophila_2:1637645_at:540:721; Interrogation_Position=747; Antisense; TTGCCCACGCGGACCATACAAAAGA
>probe:Drosophila_2:1637645_at:686:179; Interrogation_Position=880; Antisense; AAAACTGCAATCCTGTGCGTACCGT
>probe:Drosophila_2:1637645_at:177:179; Interrogation_Position=945; Antisense; AAACAACACGGCCAGAGTCGTCGAA
>probe:Drosophila_2:1637645_at:531:415; Interrogation_Position=997; Antisense; GAGCCAGTCACATTTCGTCTTGATA

Paste this into a BLAST search page for me
GCGATTTTTAAATGCTAGCCCGTACTAGCCCGTACGGACTACTTGAACAAAGAATTGGCCTTCTTAGGGCTAAATGCAGCAGCGAGGACATAGCCAACATAGGGCCTAAGGCAGCGACTCCAGAGATGGATCGACTTGCCGATACGCAAAGATACGCAAAGAGCGCTTGGTCCAAGCGCTTGGTCCAATTGTGATCACAAACAAGACCAACATGCGTTCACGAGTTCACGAGTCCTGTCCCTAAGGAAAGTTGCCCACGCGGACCATACAAAAGAAAAACTGCAATCCTGTGCGTACCGTAAACAACACGGCCAGAGTCGTCGAAGAGCCAGTCACATTTCGTCTTGATA

Full Affymetrix probeset data:

Annotations for 1637645_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720