FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637647_at:

>probe:Drosophila_2:1637647_at:724:565; Interrogation_Position=1182; Antisense; GGCAACAGCTTTATCGAACAGACCA
>probe:Drosophila_2:1637647_at:632:723; Interrogation_Position=1230; Antisense; TTGATAGTTTCCGAGTCCTGCATAG
>probe:Drosophila_2:1637647_at:396:709; Interrogation_Position=1339; Antisense; TTAAGCTGGGCTTCCATGGCTGGAT
>probe:Drosophila_2:1637647_at:298:95; Interrogation_Position=1387; Antisense; AGATTGGCGGTCCTAACTACGTGGA
>probe:Drosophila_2:1637647_at:571:519; Interrogation_Position=1419; Antisense; GTGGATGCCCCAGTGATTGTGAATA
>probe:Drosophila_2:1637647_at:223:437; Interrogation_Position=1455; Antisense; GAGGAGTTTTACAAGCAGCCCATGT
>probe:Drosophila_2:1637647_at:595:123; Interrogation_Position=1471; Antisense; AGCCCATGTTCTATGCCATTGGTCA
>probe:Drosophila_2:1637647_at:146:3; Interrogation_Position=1488; Antisense; ATTGGTCACTTCTCCAAGTGGGTTC
>probe:Drosophila_2:1637647_at:189:719; Interrogation_Position=1510; Antisense; TTCCAGAGGGATCCGTTCGCATAGA
>probe:Drosophila_2:1637647_at:291:237; Interrogation_Position=1554; Antisense; AATCTGGATTCCGTTGCATTCCTGC
>probe:Drosophila_2:1637647_at:193:715; Interrogation_Position=1603; Antisense; TTCTCTTCAATAGTGGTCGCGCCGA
>probe:Drosophila_2:1637647_at:728:449; Interrogation_Position=1626; Antisense; GATCTGGACATCACTTTGGTGGATA
>probe:Drosophila_2:1637647_at:517:93; Interrogation_Position=1663; Antisense; AGTTCGTTGTCAATGTTCCGGCCAA
>probe:Drosophila_2:1637647_at:261:235; Interrogation_Position=1687; Antisense; AATCCATTCACACTCTGCTGTACAG

Paste this into a BLAST search page for me
GGCAACAGCTTTATCGAACAGACCATTGATAGTTTCCGAGTCCTGCATAGTTAAGCTGGGCTTCCATGGCTGGATAGATTGGCGGTCCTAACTACGTGGAGTGGATGCCCCAGTGATTGTGAATAGAGGAGTTTTACAAGCAGCCCATGTAGCCCATGTTCTATGCCATTGGTCAATTGGTCACTTCTCCAAGTGGGTTCTTCCAGAGGGATCCGTTCGCATAGAAATCTGGATTCCGTTGCATTCCTGCTTCTCTTCAATAGTGGTCGCGCCGAGATCTGGACATCACTTTGGTGGATAAGTTCGTTGTCAATGTTCCGGCCAAAATCCATTCACACTCTGCTGTACAG

Full Affymetrix probeset data:

Annotations for 1637647_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720