FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637648_at:

>probe:Drosophila_2:1637648_at:432:485; Interrogation_Position=1039; Antisense; GTAGGCGGAAACAACTGCAATCTTT
>probe:Drosophila_2:1637648_at:46:363; Interrogation_Position=1055; Antisense; GCAATCTTTGCCTTAGGAGCTTCTG
>probe:Drosophila_2:1637648_at:478:551; Interrogation_Position=1070; Antisense; GGAGCTTCTGAGACCGGAAACGGAC
>probe:Drosophila_2:1637648_at:347:391; Interrogation_Position=1086; Antisense; GAAACGGACACTCGGCGGCTTTGTA
>probe:Drosophila_2:1637648_at:604:677; Interrogation_Position=1105; Antisense; TTTGTAACCTCCACTTTGCGTCCAG
>probe:Drosophila_2:1637648_at:275:693; Interrogation_Position=1119; Antisense; TTTGCGTCCAGCGATAGAGCACGAA
>probe:Drosophila_2:1637648_at:302:129; Interrogation_Position=1145; Antisense; ACCAGTCTTGTGAGAATTACCTACA
>probe:Drosophila_2:1637648_at:624:499; Interrogation_Position=1208; Antisense; GTCGGTAGACCGCAATTTTCATTAT
>probe:Drosophila_2:1637648_at:82:619; Interrogation_Position=745; Antisense; TGCAGTATCAGCCTGGGCTCCAAGC
>probe:Drosophila_2:1637648_at:344:81; Interrogation_Position=773; Antisense; AGGGCAACTACCACAGCGTGGTGAT
>probe:Drosophila_2:1637648_at:136:593; Interrogation_Position=791; Antisense; TGGTGATCATGGAGCCACCGCACGA
>probe:Drosophila_2:1637648_at:620:295; Interrogation_Position=813; Antisense; CGACGACTTCCCCATTGTTAAGTGG
>probe:Drosophila_2:1637648_at:33:153; Interrogation_Position=839; Antisense; ACATCAACGGGAACTCCCTGGACGA
>probe:Drosophila_2:1637648_at:393:449; Interrogation_Position=874; Antisense; GATCGCTGGGATGACTTCGAAGCCA

Paste this into a BLAST search page for me
GTAGGCGGAAACAACTGCAATCTTTGCAATCTTTGCCTTAGGAGCTTCTGGGAGCTTCTGAGACCGGAAACGGACGAAACGGACACTCGGCGGCTTTGTATTTGTAACCTCCACTTTGCGTCCAGTTTGCGTCCAGCGATAGAGCACGAAACCAGTCTTGTGAGAATTACCTACAGTCGGTAGACCGCAATTTTCATTATTGCAGTATCAGCCTGGGCTCCAAGCAGGGCAACTACCACAGCGTGGTGATTGGTGATCATGGAGCCACCGCACGACGACGACTTCCCCATTGTTAAGTGGACATCAACGGGAACTCCCTGGACGAGATCGCTGGGATGACTTCGAAGCCA

Full Affymetrix probeset data:

Annotations for 1637648_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720