FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637649_at:

>probe:Drosophila_2:1637649_at:304:61; Interrogation_Position=188; Antisense; ATGTACCGCATCAAGGATCCACGCA
>probe:Drosophila_2:1637649_at:132:505; Interrogation_Position=236; Antisense; GTCCTCGGGATGACCTTGCTGGTGA
>probe:Drosophila_2:1637649_at:33:439; Interrogation_Position=275; Antisense; GAGGCCAAGTTCTCGCTGTACTTTC
>probe:Drosophila_2:1637649_at:388:107; Interrogation_Position=309; Antisense; AGAACGCCACCGATGTGCCTAAGGA
>probe:Drosophila_2:1637649_at:448:657; Interrogation_Position=328; Antisense; TAAGGATCCCAAGCAGCGACGCAGC
>probe:Drosophila_2:1637649_at:714:225; Interrogation_Position=368; Antisense; AAGGCCACCATTGAGTTGACCCACA
>probe:Drosophila_2:1637649_at:394:545; Interrogation_Position=415; Antisense; GGATCAGAATTACCACACCGGCAAC
>probe:Drosophila_2:1637649_at:650:447; Interrogation_Position=443; Antisense; GATCCACGTGGTTTCGGACACATTG
>probe:Drosophila_2:1637649_at:697:3; Interrogation_Position=464; Antisense; ATTGGAATCATGGTGCCCGACGTGT
>probe:Drosophila_2:1637649_at:307:589; Interrogation_Position=593; Antisense; TGGATCGAGATCTTCAATGCACACT
>probe:Drosophila_2:1637649_at:26:605; Interrogation_Position=650; Antisense; TGATTAATTGCGCATCTGCCACTGT
>probe:Drosophila_2:1637649_at:376:641; Interrogation_Position=664; Antisense; TCTGCCACTGTTCCTTAATAGCGAT
>probe:Drosophila_2:1637649_at:271:241; Interrogation_Position=680; Antisense; AATAGCGATCCCCACTAGGCTGGAC
>probe:Drosophila_2:1637649_at:83:413; Interrogation_Position=702; Antisense; GACCGCCGAGTGGAGTCGCAACAAT

Paste this into a BLAST search page for me
ATGTACCGCATCAAGGATCCACGCAGTCCTCGGGATGACCTTGCTGGTGAGAGGCCAAGTTCTCGCTGTACTTTCAGAACGCCACCGATGTGCCTAAGGATAAGGATCCCAAGCAGCGACGCAGCAAGGCCACCATTGAGTTGACCCACAGGATCAGAATTACCACACCGGCAACGATCCACGTGGTTTCGGACACATTGATTGGAATCATGGTGCCCGACGTGTTGGATCGAGATCTTCAATGCACACTTGATTAATTGCGCATCTGCCACTGTTCTGCCACTGTTCCTTAATAGCGATAATAGCGATCCCCACTAGGCTGGACGACCGCCGAGTGGAGTCGCAACAAT

Full Affymetrix probeset data:

Annotations for 1637649_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720