Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637651_at:

>probe:Drosophila_2:1637651_at:88:715; Interrogation_Position=2814; Antisense; TTCTCCTACGGCAAACAGTTTTTGG
>probe:Drosophila_2:1637651_at:227:113; Interrogation_Position=2829; Antisense; CAGTTTTTGGTCGTAGTCAACCGCA
>probe:Drosophila_2:1637651_at:593:457; Interrogation_Position=2841; Antisense; GTAGTCAACCGCATTAATCCATCCC
>probe:Drosophila_2:1637651_at:403:235; Interrogation_Position=2856; Antisense; AATCCATCCCCATCTCAGCGTGTGT
>probe:Drosophila_2:1637651_at:577:725; Interrogation_Position=2951; Antisense; TTGTTTGAGTGGCACACACACGCAC
>probe:Drosophila_2:1637651_at:248:261; Interrogation_Position=2969; Antisense; CACGCACACACAAGCTACATACAAA
>probe:Drosophila_2:1637651_at:327:93; Interrogation_Position=3025; Antisense; AGTTCACATCACTTTTTCATCAAGA
>probe:Drosophila_2:1637651_at:595:695; Interrogation_Position=3039; Antisense; TTTCATCAAGAGATGCTCTTCAGAT
>probe:Drosophila_2:1637651_at:363:235; Interrogation_Position=3129; Antisense; AATCGAAATGGAATTGTTTTTGCCT
>probe:Drosophila_2:1637651_at:684:47; Interrogation_Position=3182; Antisense; ATCCAACAACGCGTCATTATTTTTT
>probe:Drosophila_2:1637651_at:688:655; Interrogation_Position=3244; Antisense; TAATCAGCTGGTGTATCGAGACTAA
>probe:Drosophila_2:1637651_at:590:635; Interrogation_Position=3259; Antisense; TCGAGACTAAGTACATGTGTCACAT
>probe:Drosophila_2:1637651_at:687:393; Interrogation_Position=3342; Antisense; GAAATCGTTCGATAAGGCTTAGAAA
>probe:Drosophila_2:1637651_at:240:605; Interrogation_Position=3369; Antisense; TGATTTCTTATTAACAAAACGCCAA

Paste this into a BLAST search page for me
TTCTCCTACGGCAAACAGTTTTTGGCAGTTTTTGGTCGTAGTCAACCGCAGTAGTCAACCGCATTAATCCATCCCAATCCATCCCCATCTCAGCGTGTGTTTGTTTGAGTGGCACACACACGCACCACGCACACACAAGCTACATACAAAAGTTCACATCACTTTTTCATCAAGATTTCATCAAGAGATGCTCTTCAGATAATCGAAATGGAATTGTTTTTGCCTATCCAACAACGCGTCATTATTTTTTTAATCAGCTGGTGTATCGAGACTAATCGAGACTAAGTACATGTGTCACATGAAATCGTTCGATAAGGCTTAGAAATGATTTCTTATTAACAAAACGCCAA

Full Affymetrix probeset data:

Annotations for 1637651_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime