Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637652_a_at:

>probe:Drosophila_2:1637652_a_at:653:577; Interrogation_Position=111; Antisense; GGCCGAATCACTGACTTCGATTTAT
>probe:Drosophila_2:1637652_a_at:119:461; Interrogation_Position=129; Antisense; GATTTATTCGAATCGCACCTCAGTT
>probe:Drosophila_2:1637652_a_at:314:237; Interrogation_Position=139; Antisense; AATCGCACCTCAGTTGATCCAAATG
>probe:Drosophila_2:1637652_a_at:31:723; Interrogation_Position=16; Antisense; TTGCCGCAGGACTTAGACGCTTTGA
>probe:Drosophila_2:1637652_a_at:351:463; Interrogation_Position=164; Antisense; GATTCATTCGCATTGATTCCGCCAG
>probe:Drosophila_2:1637652_a_at:413:523; Interrogation_Position=189; Antisense; GGGCATCGAGGATCGCCACCTGAAA
>probe:Drosophila_2:1637652_a_at:333:613; Interrogation_Position=209; Antisense; TGAAAGCTTCCCCAGAATTGCCCAG
>probe:Drosophila_2:1637652_a_at:684:123; Interrogation_Position=242; Antisense; AGCGCAGTTCGCAGTCGCAGAACAA
>probe:Drosophila_2:1637652_a_at:343:185; Interrogation_Position=262; Antisense; AACAAGAATCTCTATGACCTCTCCC
>probe:Drosophila_2:1637652_a_at:197:611; Interrogation_Position=276; Antisense; TGACCTCTCCCTCAAACTTATGGAT
>probe:Drosophila_2:1637652_a_at:377:139; Interrogation_Position=316; Antisense; ACGTTGGATTCCGAGTGTGCAGATG
>probe:Drosophila_2:1637652_a_at:480:497; Interrogation_Position=366; Antisense; GTCTCAACCGATTATAGCCATACCG
>probe:Drosophila_2:1637652_a_at:152:313; Interrogation_Position=382; Antisense; GCCATACCGATTGGTCAGGCTAATG
>probe:Drosophila_2:1637652_a_at:668:131; Interrogation_Position=96; Antisense; ACCGAAGAAGTTTGTGGCCGAATCA

Paste this into a BLAST search page for me
GGCCGAATCACTGACTTCGATTTATGATTTATTCGAATCGCACCTCAGTTAATCGCACCTCAGTTGATCCAAATGTTGCCGCAGGACTTAGACGCTTTGAGATTCATTCGCATTGATTCCGCCAGGGGCATCGAGGATCGCCACCTGAAATGAAAGCTTCCCCAGAATTGCCCAGAGCGCAGTTCGCAGTCGCAGAACAAAACAAGAATCTCTATGACCTCTCCCTGACCTCTCCCTCAAACTTATGGATACGTTGGATTCCGAGTGTGCAGATGGTCTCAACCGATTATAGCCATACCGGCCATACCGATTGGTCAGGCTAATGACCGAAGAAGTTTGTGGCCGAATCA

Full Affymetrix probeset data:

Annotations for 1637652_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime