FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637654_at:

>probe:Drosophila_2:1637654_at:122:75; Interrogation_Position=1163; Antisense; AGGACCAGTCGTTATTCTTTGCTAA
>probe:Drosophila_2:1637654_at:657:49; Interrogation_Position=1262; Antisense; ATGCCTGCGGCGACAATGAATCCTT
>probe:Drosophila_2:1637654_at:459:367; Interrogation_Position=1279; Antisense; GAATCCTTGCTTATTGAGCTTTCCA
>probe:Drosophila_2:1637654_at:19:501; Interrogation_Position=1319; Antisense; GTCCTCTAATAGATGCGCCGCTGGA
>probe:Drosophila_2:1637654_at:520:547; Interrogation_Position=1341; Antisense; GGATGAAGATATACCTGCCCAAAAT
>probe:Drosophila_2:1637654_at:483:355; Interrogation_Position=1367; Antisense; GCACTAACAAGCTATGGTCCCGCTT
>probe:Drosophila_2:1637654_at:122:537; Interrogation_Position=1382; Antisense; GGTCCCGCTTGTTTAGCCAGCAGAA
>probe:Drosophila_2:1637654_at:33:115; Interrogation_Position=1400; Antisense; AGCAGAATCAGCAACCCATACCGAG
>probe:Drosophila_2:1637654_at:312:415; Interrogation_Position=1422; Antisense; GAGCCAAGTAGCCACGGACTCGAAG
>probe:Drosophila_2:1637654_at:59:183; Interrogation_Position=1495; Antisense; AACAATCCCTGGCTGGATCTTTTCG
>probe:Drosophila_2:1637654_at:388:631; Interrogation_Position=1542; Antisense; TCCGCAAGCCTTCGATTTAAAACTG
>probe:Drosophila_2:1637654_at:96:523; Interrogation_Position=1582; Antisense; GTGGCCGAGCAGACCTGAGCAGATT
>probe:Drosophila_2:1637654_at:546:669; Interrogation_Position=1606; Antisense; TACCCTCCCGCACAGATTATATTTG
>probe:Drosophila_2:1637654_at:566:603; Interrogation_Position=1629; Antisense; TGTTGATCTGCATATACCGTTGGAA

Paste this into a BLAST search page for me
AGGACCAGTCGTTATTCTTTGCTAAATGCCTGCGGCGACAATGAATCCTTGAATCCTTGCTTATTGAGCTTTCCAGTCCTCTAATAGATGCGCCGCTGGAGGATGAAGATATACCTGCCCAAAATGCACTAACAAGCTATGGTCCCGCTTGGTCCCGCTTGTTTAGCCAGCAGAAAGCAGAATCAGCAACCCATACCGAGGAGCCAAGTAGCCACGGACTCGAAGAACAATCCCTGGCTGGATCTTTTCGTCCGCAAGCCTTCGATTTAAAACTGGTGGCCGAGCAGACCTGAGCAGATTTACCCTCCCGCACAGATTATATTTGTGTTGATCTGCATATACCGTTGGAA

Full Affymetrix probeset data:

Annotations for 1637654_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720