Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637655_s_at:

>probe:Drosophila_2:1637655_s_at:191:353; Interrogation_Position=108; Antisense; GCAACAACAACGTGACATGGCCAGG
>probe:Drosophila_2:1637655_s_at:303:157; Interrogation_Position=111; Antisense; ACAACAACGTGACATGGCCAGGACA
>probe:Drosophila_2:1637655_s_at:545:159; Interrogation_Position=114; Antisense; ACAACGTGACATGGCCAGGACAACA
>probe:Drosophila_2:1637655_s_at:203:511; Interrogation_Position=119; Antisense; GTGACATGGCCAGGACAACAACAAT
>probe:Drosophila_2:1637655_s_at:715:409; Interrogation_Position=15; Antisense; GACGACGCCGGCGACAACAGACAAG
>probe:Drosophila_2:1637655_s_at:438:527; Interrogation_Position=173; Antisense; GGGAGGAAAATATATGGCATACACT
>probe:Drosophila_2:1637655_s_at:153:411; Interrogation_Position=18; Antisense; GACGCCGGCGACAACAGACAAGAAC
>probe:Drosophila_2:1637655_s_at:714:21; Interrogation_Position=182; Antisense; ATATATGGCATACACTTAGGCGCGC
>probe:Drosophila_2:1637655_s_at:530:679; Interrogation_Position=185; Antisense; TATGGCATACACTTAGGCGCGCCAA
>probe:Drosophila_2:1637655_s_at:159:569; Interrogation_Position=188; Antisense; GGCATACACTTAGGCGCGCCAAGTC
>probe:Drosophila_2:1637655_s_at:658:317; Interrogation_Position=21; Antisense; GCCGGCGACAACAGACAAGAACAAC
>probe:Drosophila_2:1637655_s_at:612:397; Interrogation_Position=27; Antisense; GACAACAGACAAGAACAACGACAAC
>probe:Drosophila_2:1637655_s_at:335:107; Interrogation_Position=89; Antisense; AGAAGTCCAACGAAAGCCGGCAACA
>probe:Drosophila_2:1637655_s_at:291:373; Interrogation_Position=90; Antisense; GAAGTCCAACGAAAGCCGGCAACAA

Paste this into a BLAST search page for me
GCAACAACAACGTGACATGGCCAGGACAACAACGTGACATGGCCAGGACAACAACGTGACATGGCCAGGACAACAGTGACATGGCCAGGACAACAACAATGACGACGCCGGCGACAACAGACAAGGGGAGGAAAATATATGGCATACACTGACGCCGGCGACAACAGACAAGAACATATATGGCATACACTTAGGCGCGCTATGGCATACACTTAGGCGCGCCAAGGCATACACTTAGGCGCGCCAAGTCGCCGGCGACAACAGACAAGAACAACGACAACAGACAAGAACAACGACAACAGAAGTCCAACGAAAGCCGGCAACAGAAGTCCAACGAAAGCCGGCAACAA

Full Affymetrix probeset data:

Annotations for 1637655_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime