FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637658_at:

>probe:Drosophila_2:1637658_at:200:559; Interrogation_Position=1352; Antisense; GGACAAGCAGACTTACGCCCTATTC
>probe:Drosophila_2:1637658_at:717:687; Interrogation_Position=1372; Antisense; TATTCCTGCGACTCTTTATCATCAT
>probe:Drosophila_2:1637658_at:500:279; Interrogation_Position=1383; Antisense; CTCTTTATCATCATGGGCTTGTCCT
>probe:Drosophila_2:1637658_at:448:571; Interrogation_Position=1460; Antisense; GGCTTTTATGGTGGCTGATTACTTC
>probe:Drosophila_2:1637658_at:17:15; Interrogation_Position=1477; Antisense; ATTACTTCAATTGGTCACAGGGCAC
>probe:Drosophila_2:1637658_at:458:81; Interrogation_Position=1495; Antisense; AGGGCACCGTCATATTTCTGCTATT
>probe:Drosophila_2:1637658_at:277:697; Interrogation_Position=1509; Antisense; TTTCTGCTATTTGTTCTGAGGCCCA
>probe:Drosophila_2:1637658_at:706:575; Interrogation_Position=1528; Antisense; GGCCCAGCACACTGAAGCTACTGAA
>probe:Drosophila_2:1637658_at:524:577; Interrogation_Position=1584; Antisense; GGCGCCAGCGATGAACATATCTCAC
>probe:Drosophila_2:1637658_at:196:363; Interrogation_Position=1613; Antisense; GAATACGAAAATTGACCCCAGTGTT
>probe:Drosophila_2:1637658_at:408:279; Interrogation_Position=1720; Antisense; CTCGGCATTTATATACCCTGGTCTA
>probe:Drosophila_2:1637658_at:49:149; Interrogation_Position=1779; Antisense; ACTTTTCGCATCAGCACTTATGTAT
>probe:Drosophila_2:1637658_at:89:259; Interrogation_Position=1793; Antisense; CACTTATGTATGCTCACTCGTGATA
>probe:Drosophila_2:1637658_at:233:715; Interrogation_Position=1833; Antisense; TTCGTACTGTTTTTACTGCCTCAAC

Paste this into a BLAST search page for me
GGACAAGCAGACTTACGCCCTATTCTATTCCTGCGACTCTTTATCATCATCTCTTTATCATCATGGGCTTGTCCTGGCTTTTATGGTGGCTGATTACTTCATTACTTCAATTGGTCACAGGGCACAGGGCACCGTCATATTTCTGCTATTTTTCTGCTATTTGTTCTGAGGCCCAGGCCCAGCACACTGAAGCTACTGAAGGCGCCAGCGATGAACATATCTCACGAATACGAAAATTGACCCCAGTGTTCTCGGCATTTATATACCCTGGTCTAACTTTTCGCATCAGCACTTATGTATCACTTATGTATGCTCACTCGTGATATTCGTACTGTTTTTACTGCCTCAAC

Full Affymetrix probeset data:

Annotations for 1637658_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720