Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637662_at:

>probe:Drosophila_2:1637662_at:245:143; Interrogation_Position=1249; Antisense; ACTGGCGGTGCATCACTTGCGAGAA
>probe:Drosophila_2:1637662_at:487:601; Interrogation_Position=1276; Antisense; TGTTCCCGCACGCAAAGATGGCCAA
>probe:Drosophila_2:1637662_at:44:219; Interrogation_Position=1299; Antisense; AAGTACCAGGACTTCGCGCTGAACA
>probe:Drosophila_2:1637662_at:101:317; Interrogation_Position=1314; Antisense; GCGCTGAACACCATCAATAACCGTA
>probe:Drosophila_2:1637662_at:225:483; Interrogation_Position=1336; Antisense; GTATCAACTCGTGCAGTGTCCAGGA
>probe:Drosophila_2:1637662_at:602:515; Interrogation_Position=1351; Antisense; GTGTCCAGGACATGATCCACTTCAT
>probe:Drosophila_2:1637662_at:728:645; Interrogation_Position=1372; Antisense; TCATCAACGAGCTGTGTCCGCGCTT
>probe:Drosophila_2:1637662_at:434:297; Interrogation_Position=1408; Antisense; CGAACTACGTGCTGATCGAGGCCAA
>probe:Drosophila_2:1637662_at:28:611; Interrogation_Position=1453; Antisense; TGACGCGGTTCGACCACGAGGAGTA
>probe:Drosophila_2:1637662_at:189:427; Interrogation_Position=1488; Antisense; GAGATGGGCCACATGGATCGCTACC
>probe:Drosophila_2:1637662_at:481:339; Interrogation_Position=1507; Antisense; GCTACCGCGAGGAAGTGTTGGCCAT
>probe:Drosophila_2:1637662_at:593:415; Interrogation_Position=1546; Antisense; GAGCCGGAGAGTGTACCCTAAAGAA
>probe:Drosophila_2:1637662_at:305:47; Interrogation_Position=1691; Antisense; ATCCGAGCCCTTTGTTGCTATTTTA
>probe:Drosophila_2:1637662_at:33:369; Interrogation_Position=1747; Antisense; GAATCCTTTCGAACTATATCTGCAA

Paste this into a BLAST search page for me
ACTGGCGGTGCATCACTTGCGAGAATGTTCCCGCACGCAAAGATGGCCAAAAGTACCAGGACTTCGCGCTGAACAGCGCTGAACACCATCAATAACCGTAGTATCAACTCGTGCAGTGTCCAGGAGTGTCCAGGACATGATCCACTTCATTCATCAACGAGCTGTGTCCGCGCTTCGAACTACGTGCTGATCGAGGCCAATGACGCGGTTCGACCACGAGGAGTAGAGATGGGCCACATGGATCGCTACCGCTACCGCGAGGAAGTGTTGGCCATGAGCCGGAGAGTGTACCCTAAAGAAATCCGAGCCCTTTGTTGCTATTTTAGAATCCTTTCGAACTATATCTGCAA

Full Affymetrix probeset data:

Annotations for 1637662_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime