FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637663_at:

>probe:Drosophila_2:1637663_at:700:461; Interrogation_Position=1004; Antisense; GATTCAAAACATGGTCGGCTCCTGC
>probe:Drosophila_2:1637663_at:116:29; Interrogation_Position=1044; Antisense; ATACGCTTGGAAGGCCTGGTGCTGA
>probe:Drosophila_2:1637663_at:580:591; Interrogation_Position=1060; Antisense; TGGTGCTGACCCATTGCAACTTCAG
>probe:Drosophila_2:1637663_at:390:17; Interrogation_Position=1103; Antisense; ATTTCCCGGCTTAATCTATCGTATG
>probe:Drosophila_2:1637663_at:178:43; Interrogation_Position=1120; Antisense; ATCGTATGGTGCGACCTCGAATCGT
>probe:Drosophila_2:1637663_at:651:275; Interrogation_Position=1154; Antisense; CTTCGTGTCCGGAAAGGTGGTGCTC
>probe:Drosophila_2:1637663_at:186:583; Interrogation_Position=1347; Antisense; TGGCGAGCAGCTCCGATCGAGAATA
>probe:Drosophila_2:1637663_at:70:423; Interrogation_Position=803; Antisense; GAGAAACGCCGAGTACAATCCTAAG
>probe:Drosophila_2:1637663_at:439:235; Interrogation_Position=819; Antisense; AATCCTAAGCGATTTGCGGCTGTGA
>probe:Drosophila_2:1637663_at:638:603; Interrogation_Position=841; Antisense; TGATTATGCGAATCCGAGAGCCCCG
>probe:Drosophila_2:1637663_at:293:703; Interrogation_Position=877; Antisense; TTATTTTCAGCTCCGGCAAGATGGT
>probe:Drosophila_2:1637663_at:644:83; Interrogation_Position=918; Antisense; AGTGAGGACGACTCCAGACTGGCAG
>probe:Drosophila_2:1637663_at:88:91; Interrogation_Position=949; Antisense; AGTATGCGCGCATCATCCAAAAGCT
>probe:Drosophila_2:1637663_at:568:255; Interrogation_Position=966; Antisense; CAAAAGCTCGGTTTCCCTGCAAAGT

Paste this into a BLAST search page for me
GATTCAAAACATGGTCGGCTCCTGCATACGCTTGGAAGGCCTGGTGCTGATGGTGCTGACCCATTGCAACTTCAGATTTCCCGGCTTAATCTATCGTATGATCGTATGGTGCGACCTCGAATCGTCTTCGTGTCCGGAAAGGTGGTGCTCTGGCGAGCAGCTCCGATCGAGAATAGAGAAACGCCGAGTACAATCCTAAGAATCCTAAGCGATTTGCGGCTGTGATGATTATGCGAATCCGAGAGCCCCGTTATTTTCAGCTCCGGCAAGATGGTAGTGAGGACGACTCCAGACTGGCAGAGTATGCGCGCATCATCCAAAAGCTCAAAAGCTCGGTTTCCCTGCAAAGT

Full Affymetrix probeset data:

Annotations for 1637663_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720