FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637664_at:

>probe:Drosophila_2:1637664_at:418:249; Interrogation_Position=1288; Antisense; CAATGGGAACAACACCTTTGGCGGG
>probe:Drosophila_2:1637664_at:15:187; Interrogation_Position=1316; Antisense; AACAATCATCCTGTGCACGGAGCAT
>probe:Drosophila_2:1637664_at:377:431; Interrogation_Position=1343; Antisense; GAGTCGGCATCATCTGGAACAGGTC
>probe:Drosophila_2:1637664_at:601:153; Interrogation_Position=1361; Antisense; ACAGGTCCTAGTTCGAGCAATCAAT
>probe:Drosophila_2:1637664_at:446:33; Interrogation_Position=1380; Antisense; ATCAATTCGCCGTACGCGACGATGA
>probe:Drosophila_2:1637664_at:320:607; Interrogation_Position=1402; Antisense; TGATGATCGGCCCAAGCTAGTGCTC
>probe:Drosophila_2:1637664_at:273:85; Interrogation_Position=1420; Antisense; AGTGCTCAAGCCCAGGACTGTGACT
>probe:Drosophila_2:1637664_at:174:71; Interrogation_Position=1476; Antisense; AGGCTGCTCTCATCTTCGGAAAGGC
>probe:Drosophila_2:1637664_at:47:77; Interrogation_Position=1558; Antisense; AGGATCGTCAGGTGCTCCAAGTGAT
>probe:Drosophila_2:1637664_at:477:453; Interrogation_Position=1586; Antisense; GATCATGATCCAGGCTTGGGCGACA
>probe:Drosophila_2:1637664_at:438:473; Interrogation_Position=1656; Antisense; GTTCAGCATGGCGAGATCTTTCAAT
>probe:Drosophila_2:1637664_at:450:601; Interrogation_Position=1717; Antisense; TGTATCCACTGATGTTCGTGCACTT
>probe:Drosophila_2:1637664_at:544:509; Interrogation_Position=1734; Antisense; GTGCACTTCGTCCTCGAAATCAAGA
>probe:Drosophila_2:1637664_at:300:45; Interrogation_Position=1806; Antisense; ATCCATTGGCTTGTTTTTTCGCTTG

Paste this into a BLAST search page for me
CAATGGGAACAACACCTTTGGCGGGAACAATCATCCTGTGCACGGAGCATGAGTCGGCATCATCTGGAACAGGTCACAGGTCCTAGTTCGAGCAATCAATATCAATTCGCCGTACGCGACGATGATGATGATCGGCCCAAGCTAGTGCTCAGTGCTCAAGCCCAGGACTGTGACTAGGCTGCTCTCATCTTCGGAAAGGCAGGATCGTCAGGTGCTCCAAGTGATGATCATGATCCAGGCTTGGGCGACAGTTCAGCATGGCGAGATCTTTCAATTGTATCCACTGATGTTCGTGCACTTGTGCACTTCGTCCTCGAAATCAAGAATCCATTGGCTTGTTTTTTCGCTTG

Full Affymetrix probeset data:

Annotations for 1637664_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720