Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637665_at:

>probe:Drosophila_2:1637665_at:467:719; Interrogation_Position=1717; Antisense; TTCCGCGAAATGCTCGACGAGATTA
>probe:Drosophila_2:1637665_at:473:407; Interrogation_Position=1732; Antisense; GACGAGATTAGCACTCTTCAGCTTA
>probe:Drosophila_2:1637665_at:62:147; Interrogation_Position=1744; Antisense; ACTCTTCAGCTTACTAGCACTTGGA
>probe:Drosophila_2:1637665_at:373:215; Interrogation_Position=1793; Antisense; AAGATCCGCGATACCTAAAATACAA
>probe:Drosophila_2:1637665_at:67:327; Interrogation_Position=1829; Antisense; GCGAGCGCGAGTTCCGGGACTACAT
>probe:Drosophila_2:1637665_at:572:375; Interrogation_Position=1875; Antisense; GAAGACTTCTCTTCGGGAACTCCTG
>probe:Drosophila_2:1637665_at:370:213; Interrogation_Position=1924; Antisense; AAGAGCAGCGATCTCATCAAGGAAA
>probe:Drosophila_2:1637665_at:554:559; Interrogation_Position=1944; Antisense; GGAAAATCCAAACCATCTCAAAGAG
>probe:Drosophila_2:1637665_at:628:205; Interrogation_Position=1993; Antisense; AAGCGCTATTTGGTGCTCGATCACA
>probe:Drosophila_2:1637665_at:540:187; Interrogation_Position=2032; Antisense; AACACTATTGTGCTCGGCTTTTTGG
>probe:Drosophila_2:1637665_at:235:587; Interrogation_Position=2054; Antisense; TGGAGGAGCTCAACAAACGCGGCCC
>probe:Drosophila_2:1637665_at:149:651; Interrogation_Position=2104; Antisense; TCAACGCGCCGCAACAAGTAGAGTG
>probe:Drosophila_2:1637665_at:454:685; Interrogation_Position=2174; Antisense; TATACTAAGACGAAGTTCCGCATCT
>probe:Drosophila_2:1637665_at:241:471; Interrogation_Position=2188; Antisense; GTTCCGCATCTTCGAATATTTTAAT

Paste this into a BLAST search page for me
TTCCGCGAAATGCTCGACGAGATTAGACGAGATTAGCACTCTTCAGCTTAACTCTTCAGCTTACTAGCACTTGGAAAGATCCGCGATACCTAAAATACAAGCGAGCGCGAGTTCCGGGACTACATGAAGACTTCTCTTCGGGAACTCCTGAAGAGCAGCGATCTCATCAAGGAAAGGAAAATCCAAACCATCTCAAAGAGAAGCGCTATTTGGTGCTCGATCACAAACACTATTGTGCTCGGCTTTTTGGTGGAGGAGCTCAACAAACGCGGCCCTCAACGCGCCGCAACAAGTAGAGTGTATACTAAGACGAAGTTCCGCATCTGTTCCGCATCTTCGAATATTTTAAT

Full Affymetrix probeset data:

Annotations for 1637665_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime