Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637666_at:

>probe:Drosophila_2:1637666_at:298:205; Interrogation_Position=1977; Antisense; AAGCGCATCCGGGTGAAGTCCGCCG
>probe:Drosophila_2:1637666_at:700:613; Interrogation_Position=1990; Antisense; TGAAGTCCGCCGACTTGGATGCGGA
>probe:Drosophila_2:1637666_at:707:289; Interrogation_Position=2011; Antisense; CGGATGAGGATTGAGGCAGCTTTAT
>probe:Drosophila_2:1637666_at:655:653; Interrogation_Position=2118; Antisense; TAAGGAATTATAGGATGCAGCCAAT
>probe:Drosophila_2:1637666_at:133:493; Interrogation_Position=2147; Antisense; GTAAGCTATTAGTTCAGATTCTTGA
>probe:Drosophila_2:1637666_at:19:15; Interrogation_Position=2194; Antisense; ATATACTAAACATCCGACTGAACGA
>probe:Drosophila_2:1637666_at:89:405; Interrogation_Position=2209; Antisense; GACTGAACGAACAATCCCTACAAAT
>probe:Drosophila_2:1637666_at:185:107; Interrogation_Position=2259; Antisense; AAAGTACAATGTTTTCAACTAGCAT
>probe:Drosophila_2:1637666_at:66:485; Interrogation_Position=2290; Antisense; GTATCCTAATCTTCTTATGATCCTA
>probe:Drosophila_2:1637666_at:514:289; Interrogation_Position=2339; Antisense; CGGATTTGATCGTAGTTGTTTCTAT
>probe:Drosophila_2:1637666_at:679:511; Interrogation_Position=2398; Antisense; GTGACTATATATACATTGCTTCTAA
>probe:Drosophila_2:1637666_at:400:7; Interrogation_Position=2412; Antisense; ATTGCTTCTAAGTTCCTTTTGTTGG
>probe:Drosophila_2:1637666_at:188:215; Interrogation_Position=2421; Antisense; AAGTTCCTTTTGTTGGTTGATAGCA
>probe:Drosophila_2:1637666_at:470:35; Interrogation_Position=2493; Antisense; ATCAGGATTCTTTCAGAACCAGCAG

Paste this into a BLAST search page for me
AAGCGCATCCGGGTGAAGTCCGCCGTGAAGTCCGCCGACTTGGATGCGGACGGATGAGGATTGAGGCAGCTTTATTAAGGAATTATAGGATGCAGCCAATGTAAGCTATTAGTTCAGATTCTTGAATATACTAAACATCCGACTGAACGAGACTGAACGAACAATCCCTACAAATAAAGTACAATGTTTTCAACTAGCATGTATCCTAATCTTCTTATGATCCTACGGATTTGATCGTAGTTGTTTCTATGTGACTATATATACATTGCTTCTAAATTGCTTCTAAGTTCCTTTTGTTGGAAGTTCCTTTTGTTGGTTGATAGCAATCAGGATTCTTTCAGAACCAGCAG

Full Affymetrix probeset data:

Annotations for 1637666_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime