FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637667_at:

>probe:Drosophila_2:1637667_at:65:227; Interrogation_Position=192; Antisense; AAGGAATTTCACAGCGCGACGCGTT
>probe:Drosophila_2:1637667_at:195:717; Interrogation_Position=216; Antisense; TTCTGTGGCCAAACTGTCGTCTGCA
>probe:Drosophila_2:1637667_at:440:235; Interrogation_Position=260; Antisense; AATCCTGCAACGGTTCTCATGCGGA
>probe:Drosophila_2:1637667_at:277:331; Interrogation_Position=280; Antisense; GCGGATAACAGTTCGCCGGACAGTC
>probe:Drosophila_2:1637667_at:502:427; Interrogation_Position=346; Antisense; GAGATCAAGTTAGCCGTGCCCAAAT
>probe:Drosophila_2:1637667_at:682:507; Interrogation_Position=382; Antisense; GTGCGCAAGCAGAACGAGGCCCATA
>probe:Drosophila_2:1637667_at:630:293; Interrogation_Position=396; Antisense; CGAGGCCCATATCATATCCAACATT
>probe:Drosophila_2:1637667_at:605:653; Interrogation_Position=441; Antisense; TAAGGATTCTAACTTTATCGCCCCA
>probe:Drosophila_2:1637667_at:111:149; Interrogation_Position=485; Antisense; ACTTCGCTCCGAATCGTGTTGTATT
>probe:Drosophila_2:1637667_at:373:287; Interrogation_Position=517; Antisense; CTGGTGCCTCTCAATGTCAACGATT
>probe:Drosophila_2:1637667_at:281:61; Interrogation_Position=530; Antisense; ATGTCAACGATTCTGTGCTGGTGCC
>probe:Drosophila_2:1637667_at:570:561; Interrogation_Position=678; Antisense; GGAACCAGTACTCCACTTGGATTGG
>probe:Drosophila_2:1637667_at:154:539; Interrogation_Position=696; Antisense; GGATTGGGAACCAGGACCCTTCGAT
>probe:Drosophila_2:1637667_at:148:133; Interrogation_Position=711; Antisense; ACCCTTCGATTTTTTCGGCGCATAT

Paste this into a BLAST search page for me
AAGGAATTTCACAGCGCGACGCGTTTTCTGTGGCCAAACTGTCGTCTGCAAATCCTGCAACGGTTCTCATGCGGAGCGGATAACAGTTCGCCGGACAGTCGAGATCAAGTTAGCCGTGCCCAAATGTGCGCAAGCAGAACGAGGCCCATACGAGGCCCATATCATATCCAACATTTAAGGATTCTAACTTTATCGCCCCAACTTCGCTCCGAATCGTGTTGTATTCTGGTGCCTCTCAATGTCAACGATTATGTCAACGATTCTGTGCTGGTGCCGGAACCAGTACTCCACTTGGATTGGGGATTGGGAACCAGGACCCTTCGATACCCTTCGATTTTTTCGGCGCATAT

Full Affymetrix probeset data:

Annotations for 1637667_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720