Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637669_at:

>probe:Drosophila_2:1637669_at:219:543; Interrogation_Position=1124; Antisense; GGATTGTCCACGTGCTGGTCTACTA
>probe:Drosophila_2:1637669_at:294:537; Interrogation_Position=1140; Antisense; GGTCTACTACGGATTGAGCCTTAAT
>probe:Drosophila_2:1637669_at:117:343; Interrogation_Position=1201; Antisense; GCTTACATCGCCCTGGTTGAGATTC
>probe:Drosophila_2:1637669_at:369:467; Interrogation_Position=1216; Antisense; GTTGAGATTCCAGGCTTCTTCATGC
>probe:Drosophila_2:1637669_at:624:121; Interrogation_Position=1300; Antisense; AGCGGTCTTTGCTGCATCGGAACGA
>probe:Drosophila_2:1637669_at:714:559; Interrogation_Position=1318; Antisense; GGAACGATATTCACCGGCGCGGATC
>probe:Drosophila_2:1637669_at:282:267; Interrogation_Position=1346; Antisense; CAGTGCTTCAATTGGTGCTATTTCT
>probe:Drosophila_2:1637669_at:421:427; Interrogation_Position=1426; Antisense; GAGATCTATCCCACGAATCTGAGAA
>probe:Drosophila_2:1637669_at:541:389; Interrogation_Position=1448; Antisense; GAAACAGTCTGCTTAGCTTCTGCTC
>probe:Drosophila_2:1637669_at:61:105; Interrogation_Position=1508; Antisense; AGACGCCTCTTCTGGCCAAGTATTA
>probe:Drosophila_2:1637669_at:689:217; Interrogation_Position=1525; Antisense; AAGTATTATGCCAATGCTCCTGCCA
>probe:Drosophila_2:1637669_at:136:643; Interrogation_Position=1597; Antisense; TTTCCAGAGACCACCAACGTAGTTT
>probe:Drosophila_2:1637669_at:657:187; Interrogation_Position=1629; Antisense; AACAGTGCAGGAAGCGGACGCCATA
>probe:Drosophila_2:1637669_at:582:77; Interrogation_Position=1679; Antisense; AGGATCTTGATCTAGTCGTCACGGC

Paste this into a BLAST search page for me
GGATTGTCCACGTGCTGGTCTACTAGGTCTACTACGGATTGAGCCTTAATGCTTACATCGCCCTGGTTGAGATTCGTTGAGATTCCAGGCTTCTTCATGCAGCGGTCTTTGCTGCATCGGAACGAGGAACGATATTCACCGGCGCGGATCCAGTGCTTCAATTGGTGCTATTTCTGAGATCTATCCCACGAATCTGAGAAGAAACAGTCTGCTTAGCTTCTGCTCAGACGCCTCTTCTGGCCAAGTATTAAAGTATTATGCCAATGCTCCTGCCATTTCCAGAGACCACCAACGTAGTTTAACAGTGCAGGAAGCGGACGCCATAAGGATCTTGATCTAGTCGTCACGGC

Full Affymetrix probeset data:

Annotations for 1637669_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime