Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637670_s_at:

>probe:Drosophila_2:1637670_s_at:137:239; Interrogation_Position=100; Antisense; CAATCCGGAACAGTAGCGGTGCCCT
>probe:Drosophila_2:1637670_s_at:668:559; Interrogation_Position=106; Antisense; GGAACAGTAGCGGTGCCCTCCACGA
>probe:Drosophila_2:1637670_s_at:706:127; Interrogation_Position=130; Antisense; ACCACTTCTGTGGTGGCAGCAGCAG
>probe:Drosophila_2:1637670_s_at:400:357; Interrogation_Position=157; Antisense; GCAACAGTGGCTGCCGCCCATGGAT
>probe:Drosophila_2:1637670_s_at:314:521; Interrogation_Position=163; Antisense; GTGGCTGCCGCCCATGGATACCGCA
>probe:Drosophila_2:1637670_s_at:215:63; Interrogation_Position=34; Antisense; ATGTCCACAGATAATCCCACACAGT
>probe:Drosophila_2:1637670_s_at:622:93; Interrogation_Position=42; Antisense; AGATAATCCCACACAGTTGCTGACC
>probe:Drosophila_2:1637670_s_at:203:93; Interrogation_Position=56; Antisense; AGTTGCTGACCACCCGTGATTTGAG
>probe:Drosophila_2:1637670_s_at:659:609; Interrogation_Position=62; Antisense; TGACCACCCGTGATTTGAGCCAACT
>probe:Drosophila_2:1637670_s_at:695:131; Interrogation_Position=67; Antisense; ACCCGTGATTTGAGCCAACTGCGTG
>probe:Drosophila_2:1637670_s_at:120:605; Interrogation_Position=72; Antisense; TGATTTGAGCCAACTGCGTGGACAT
>probe:Drosophila_2:1637670_s_at:156:195; Interrogation_Position=83; Antisense; AACTGCGTGGACATCTGCAATCCGG
>probe:Drosophila_2:1637670_s_at:557:329; Interrogation_Position=87; Antisense; GCGTGGACATCTGCAATCCGGAACA
>probe:Drosophila_2:1637670_s_at:623:557; Interrogation_Position=91; Antisense; GGACATCTGCAATCCGGAACAGTAG

Paste this into a BLAST search page for me
CAATCCGGAACAGTAGCGGTGCCCTGGAACAGTAGCGGTGCCCTCCACGAACCACTTCTGTGGTGGCAGCAGCAGGCAACAGTGGCTGCCGCCCATGGATGTGGCTGCCGCCCATGGATACCGCAATGTCCACAGATAATCCCACACAGTAGATAATCCCACACAGTTGCTGACCAGTTGCTGACCACCCGTGATTTGAGTGACCACCCGTGATTTGAGCCAACTACCCGTGATTTGAGCCAACTGCGTGTGATTTGAGCCAACTGCGTGGACATAACTGCGTGGACATCTGCAATCCGGGCGTGGACATCTGCAATCCGGAACAGGACATCTGCAATCCGGAACAGTAG

Full Affymetrix probeset data:

Annotations for 1637670_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime