FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637672_at:

>probe:Drosophila_2:1637672_at:637:211; Interrogation_Position=124; Antisense; AAGACGACCACCATCGTTAGCCACA
>probe:Drosophila_2:1637672_at:167:71; Interrogation_Position=167; Antisense; AGGCCGATGGCTTCTGGGTCAACAA
>probe:Drosophila_2:1637672_at:192:185; Interrogation_Position=187; Antisense; AACAAGACGACGTGGAACGCTCGCT
>probe:Drosophila_2:1637672_at:163:199; Interrogation_Position=202; Antisense; AACGCTCGCTGGGTAAAGTACTGGC
>probe:Drosophila_2:1637672_at:342:327; Interrogation_Position=225; Antisense; GCGGGCCAAGAAGATCTACGAGCCG
>probe:Drosophila_2:1637672_at:2:645; Interrogation_Position=239; Antisense; TCTACGAGCCGGTGTGGAAAAAGGT
>probe:Drosophila_2:1637672_at:536:387; Interrogation_Position=255; Antisense; GAAAAAGGTCTGGACACCCACCATT
>probe:Drosophila_2:1637672_at:545:13; Interrogation_Position=277; Antisense; ATTCACAACGAGTGGGTGCCCTTGC
>probe:Drosophila_2:1637672_at:582:83; Interrogation_Position=28; Antisense; AGTGGCGACAGGATGGCGTATCCAT
>probe:Drosophila_2:1637672_at:495:533; Interrogation_Position=291; Antisense; GGTGCCCTTGCCCAATGTGCCCAAT
>probe:Drosophila_2:1637672_at:181:547; Interrogation_Position=321; Antisense; GGAGGCGGAAAAGGATCGCTCCTAA
>probe:Drosophila_2:1637672_at:120:61; Interrogation_Position=51; Antisense; ATGGATTAAAATGAGGCCCCTGCTG
>probe:Drosophila_2:1637672_at:189:321; Interrogation_Position=66; Antisense; GCCCCTGCTGATGCTGACAGTAATA
>probe:Drosophila_2:1637672_at:678:3; Interrogation_Position=90; Antisense; ATTGGTCATTTTCTTCAGCTACGGC

Paste this into a BLAST search page for me
AAGACGACCACCATCGTTAGCCACAAGGCCGATGGCTTCTGGGTCAACAAAACAAGACGACGTGGAACGCTCGCTAACGCTCGCTGGGTAAAGTACTGGCGCGGGCCAAGAAGATCTACGAGCCGTCTACGAGCCGGTGTGGAAAAAGGTGAAAAAGGTCTGGACACCCACCATTATTCACAACGAGTGGGTGCCCTTGCAGTGGCGACAGGATGGCGTATCCATGGTGCCCTTGCCCAATGTGCCCAATGGAGGCGGAAAAGGATCGCTCCTAAATGGATTAAAATGAGGCCCCTGCTGGCCCCTGCTGATGCTGACAGTAATAATTGGTCATTTTCTTCAGCTACGGC

Full Affymetrix probeset data:

Annotations for 1637672_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720