FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637673_at:

>probe:Drosophila_2:1637673_at:222:317; Interrogation_Position=1276; Antisense; GCCTGATGCGCCAAGAGACCGTCAA
>probe:Drosophila_2:1637673_at:275:413; Interrogation_Position=1292; Antisense; GACCGTCAAGGCGATTCAATCTCTG
>probe:Drosophila_2:1637673_at:696:237; Interrogation_Position=1309; Antisense; AATCTCTGGAGATGGCCCAACGCAC
>probe:Drosophila_2:1637673_at:403:125; Interrogation_Position=1346; Antisense; AGCCGGCCTGCAGTTCGAGAACAAT
>probe:Drosophila_2:1637673_at:573:421; Interrogation_Position=1362; Antisense; GAGAACAATGCTCCGTTCCAGTACT
>probe:Drosophila_2:1637673_at:218:89; Interrogation_Position=1381; Antisense; AGTACTTTCAGTGCCTGGTGGCGAA
>probe:Drosophila_2:1637673_at:474:19; Interrogation_Position=1417; Antisense; ATTTGATCGCCTTTCGCCAGCAGAT
>probe:Drosophila_2:1637673_at:20:135; Interrogation_Position=1465; Antisense; ACGCGATCTCGAATCCGCAGAGTAT
>probe:Drosophila_2:1637673_at:315:297; Interrogation_Position=1480; Antisense; CGCAGAGTATTTCGCCGGATGATCT
>probe:Drosophila_2:1637673_at:88:427; Interrogation_Position=1530; Antisense; GAGAGTTTCATCTCGCTGGCGGGAC
>probe:Drosophila_2:1637673_at:639:127; Interrogation_Position=1632; Antisense; ACCACCAACGTTTTCGAGCGGATTG
>probe:Drosophila_2:1637673_at:492:1; Interrogation_Position=1673; Antisense; GACGGTGGAACCTCAACGGATTAGT
>probe:Drosophila_2:1637673_at:622:539; Interrogation_Position=1690; Antisense; GGATTAGTAGCGGTCCAACGCCCTT
>probe:Drosophila_2:1637673_at:272:613; Interrogation_Position=1735; Antisense; TGAACAAGTCCTATGCAGCGGCGGC

Paste this into a BLAST search page for me
GCCTGATGCGCCAAGAGACCGTCAAGACCGTCAAGGCGATTCAATCTCTGAATCTCTGGAGATGGCCCAACGCACAGCCGGCCTGCAGTTCGAGAACAATGAGAACAATGCTCCGTTCCAGTACTAGTACTTTCAGTGCCTGGTGGCGAAATTTGATCGCCTTTCGCCAGCAGATACGCGATCTCGAATCCGCAGAGTATCGCAGAGTATTTCGCCGGATGATCTGAGAGTTTCATCTCGCTGGCGGGACACCACCAACGTTTTCGAGCGGATTGGACGGTGGAACCTCAACGGATTAGTGGATTAGTAGCGGTCCAACGCCCTTTGAACAAGTCCTATGCAGCGGCGGC

Full Affymetrix probeset data:

Annotations for 1637673_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720