Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637674_at:

>probe:Drosophila_2:1637674_at:2:287; Interrogation_Position=1067; Antisense; CTGGCGAGAGTTGGATTGACCTACT
>probe:Drosophila_2:1637674_at:413:477; Interrogation_Position=1104; Antisense; GTTTGATTGGGCACCATACTTGCTC
>probe:Drosophila_2:1637674_at:333:29; Interrogation_Position=1119; Antisense; ATACTTGCTCTTCTATCGGGACGCC
>probe:Drosophila_2:1637674_at:366:453; Interrogation_Position=1180; Antisense; GATCTCAGGCAGCAGTATCTAGCAG
>probe:Drosophila_2:1637674_at:271:351; Interrogation_Position=1201; Antisense; GCAGATCGGCGATTCAGTGTGGAAA
>probe:Drosophila_2:1637674_at:129:629; Interrogation_Position=1317; Antisense; TCCGGTTTATTCTTTTGTCTACGAT
>probe:Drosophila_2:1637674_at:331:137; Interrogation_Position=1337; Antisense; ACGATAATCCTACCGATTCCGGAGT
>probe:Drosophila_2:1637674_at:610:9; Interrogation_Position=1352; Antisense; ATTCCGGAGTGGGTCAATTGCTTTC
>probe:Drosophila_2:1637674_at:187:667; Interrogation_Position=1391; Antisense; TACATTTTGGTACTGTCCACGGAGA
>probe:Drosophila_2:1637674_at:472:627; Interrogation_Position=1406; Antisense; TCCACGGAGATGACTTTTTCTTGAT
>probe:Drosophila_2:1637674_at:309:709; Interrogation_Position=1432; Antisense; TTCAATACAGCTGCATACCGTACCG
>probe:Drosophila_2:1637674_at:519:333; Interrogation_Position=1503; Antisense; GCTGGAGGATTTCGCACTCAACGAT
>probe:Drosophila_2:1637674_at:514:653; Interrogation_Position=1587; Antisense; TCAAGTGCTGCGTATTTCACGAAAC
>probe:Drosophila_2:1637674_at:82:293; Interrogation_Position=1623; Antisense; CGAGGAATATGCTCGGTTTCCCTAA

Paste this into a BLAST search page for me
CTGGCGAGAGTTGGATTGACCTACTGTTTGATTGGGCACCATACTTGCTCATACTTGCTCTTCTATCGGGACGCCGATCTCAGGCAGCAGTATCTAGCAGGCAGATCGGCGATTCAGTGTGGAAATCCGGTTTATTCTTTTGTCTACGATACGATAATCCTACCGATTCCGGAGTATTCCGGAGTGGGTCAATTGCTTTCTACATTTTGGTACTGTCCACGGAGATCCACGGAGATGACTTTTTCTTGATTTCAATACAGCTGCATACCGTACCGGCTGGAGGATTTCGCACTCAACGATTCAAGTGCTGCGTATTTCACGAAACCGAGGAATATGCTCGGTTTCCCTAA

Full Affymetrix probeset data:

Annotations for 1637674_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime