Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637676_at:

>probe:Drosophila_2:1637676_at:145:83; Interrogation_Position=1103; Antisense; AGTGGCTACTCTCGAACCCGAAAAT
>probe:Drosophila_2:1637676_at:20:387; Interrogation_Position=1122; Antisense; GAAAATCGAGCCGTTCAATCGGATT
>probe:Drosophila_2:1637676_at:353:39; Interrogation_Position=1139; Antisense; ATCGGATTTGGCCAGACTTTTCATC
>probe:Drosophila_2:1637676_at:568:401; Interrogation_Position=1153; Antisense; GACTTTTCATCAAGGCTCGTCGTGA
>probe:Drosophila_2:1637676_at:435:481; Interrogation_Position=1199; Antisense; GTATCAAAAGATGCTGGGCCAGGCC
>probe:Drosophila_2:1637676_at:282:553; Interrogation_Position=1232; Antisense; GGAGCAGAATACTGCCACCAGGCAA
>probe:Drosophila_2:1637676_at:632:183; Interrogation_Position=1255; Antisense; AAAAGCAGCCGCTTGTCGACAATTC
>probe:Drosophila_2:1637676_at:114:119; Interrogation_Position=1288; Antisense; AGCTGCTTGGCTATCTAATGGGTAC
>probe:Drosophila_2:1637676_at:640:687; Interrogation_Position=1315; Antisense; TATTAATTGGAGTGGCTGGCGTCGC
>probe:Drosophila_2:1637676_at:109:333; Interrogation_Position=1329; Antisense; GCTGGCGTCGCTATTTATCGTTACA
>probe:Drosophila_2:1637676_at:40:117; Interrogation_Position=1367; Antisense; AGCATTGCACACGAACTACTGGTTA
>probe:Drosophila_2:1637676_at:513:57; Interrogation_Position=1471; Antisense; ATGATGATATGGCTCTCGTTGTACA
>probe:Drosophila_2:1637676_at:425:571; Interrogation_Position=1481; Antisense; GGCTCTCGTTGTACATTTAATGCTA
>probe:Drosophila_2:1637676_at:484:239; Interrogation_Position=1584; Antisense; AATCAACTACATTCTGTCAGACAAG

Paste this into a BLAST search page for me
AGTGGCTACTCTCGAACCCGAAAATGAAAATCGAGCCGTTCAATCGGATTATCGGATTTGGCCAGACTTTTCATCGACTTTTCATCAAGGCTCGTCGTGAGTATCAAAAGATGCTGGGCCAGGCCGGAGCAGAATACTGCCACCAGGCAAAAAAGCAGCCGCTTGTCGACAATTCAGCTGCTTGGCTATCTAATGGGTACTATTAATTGGAGTGGCTGGCGTCGCGCTGGCGTCGCTATTTATCGTTACAAGCATTGCACACGAACTACTGGTTAATGATGATATGGCTCTCGTTGTACAGGCTCTCGTTGTACATTTAATGCTAAATCAACTACATTCTGTCAGACAAG

Full Affymetrix probeset data:

Annotations for 1637676_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime