Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637677_at:

>probe:Drosophila_2:1637677_at:691:153; Interrogation_Position=1182; Antisense; ACAGTCATGGTTATGGCCTGCTCAA
>probe:Drosophila_2:1637677_at:50:655; Interrogation_Position=1203; Antisense; TCAATGATTACCCTCAGCAGCAGAC
>probe:Drosophila_2:1637677_at:194:487; Interrogation_Position=1258; Antisense; GTACCAACATCAGTGCAGCTACCAG
>probe:Drosophila_2:1637677_at:31:675; Interrogation_Position=1301; Antisense; TACCATCTGTCTTGAGGTCCGGCGA
>probe:Drosophila_2:1637677_at:176:79; Interrogation_Position=1315; Antisense; AGGTCCGGCGATGCTCAGTTACTCT
>probe:Drosophila_2:1637677_at:477:149; Interrogation_Position=1388; Antisense; ACTTCTCTCGACCATTTGTAGGTGA
>probe:Drosophila_2:1637677_at:406:399; Interrogation_Position=1411; Antisense; GACACGCAAATGACACAGCCGAGAA
>probe:Drosophila_2:1637677_at:3:209; Interrogation_Position=1438; Antisense; AAGCTGCGACGCGATGAGTTGCACA
>probe:Drosophila_2:1637677_at:131:93; Interrogation_Position=1454; Antisense; AGTTGCACAGTAGAGGGCGCACTCC
>probe:Drosophila_2:1637677_at:186:185; Interrogation_Position=1559; Antisense; AAAAGGAGCCTTGCTGCGCGCGGAA
>probe:Drosophila_2:1637677_at:552:331; Interrogation_Position=1578; Antisense; GCGGAACCCAGTGGCTGGCCATGAT
>probe:Drosophila_2:1637677_at:723:313; Interrogation_Position=1595; Antisense; GCCATGATGGGTTCTCAGCGATCGA
>probe:Drosophila_2:1637677_at:595:327; Interrogation_Position=1612; Antisense; GCGATCGATTAGCTGCGGCCAAACA
>probe:Drosophila_2:1637677_at:228:403; Interrogation_Position=1677; Antisense; GACTTGGAGACTGACACACATGTTT

Paste this into a BLAST search page for me
ACAGTCATGGTTATGGCCTGCTCAATCAATGATTACCCTCAGCAGCAGACGTACCAACATCAGTGCAGCTACCAGTACCATCTGTCTTGAGGTCCGGCGAAGGTCCGGCGATGCTCAGTTACTCTACTTCTCTCGACCATTTGTAGGTGAGACACGCAAATGACACAGCCGAGAAAAGCTGCGACGCGATGAGTTGCACAAGTTGCACAGTAGAGGGCGCACTCCAAAAGGAGCCTTGCTGCGCGCGGAAGCGGAACCCAGTGGCTGGCCATGATGCCATGATGGGTTCTCAGCGATCGAGCGATCGATTAGCTGCGGCCAAACAGACTTGGAGACTGACACACATGTTT

Full Affymetrix probeset data:

Annotations for 1637677_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime