FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637678_at:

>probe:Drosophila_2:1637678_at:267:625; Interrogation_Position=356; Antisense; TGCCCCACAAGAAGCTCACTGATAT
>probe:Drosophila_2:1637678_at:684:213; Interrogation_Position=416; Antisense; AAGAGGTCTCCCAGATTTGGCTGGA
>probe:Drosophila_2:1637678_at:555:463; Interrogation_Position=557; Antisense; GATTCGAGTTTGTCATGCTCCAGTT
>probe:Drosophila_2:1637678_at:119:701; Interrogation_Position=611; Antisense; TTTTGGCGTACCAGGTGCACCATGA
>probe:Drosophila_2:1637678_at:618:509; Interrogation_Position=625; Antisense; GTGCACCATGAGAACGCTCCGGAGT
>probe:Drosophila_2:1637678_at:12:631; Interrogation_Position=642; Antisense; TCCGGAGTGTCTCACAGTGGTTCAC
>probe:Drosophila_2:1637678_at:540:79; Interrogation_Position=657; Antisense; AGTGGTTCACTATACCGAGGTCCAA
>probe:Drosophila_2:1637678_at:477:251; Interrogation_Position=684; Antisense; CAAGGGTGTAGTTCTCATGCGCGGT
>probe:Drosophila_2:1637678_at:643:655; Interrogation_Position=720; Antisense; TAAGGTACTCACAGCCCAGGAGGCT
>probe:Drosophila_2:1637678_at:143:99; Interrogation_Position=767; Antisense; AGATGTTCTACCTGAAGCCCGACGA
>probe:Drosophila_2:1637678_at:309:343; Interrogation_Position=803; Antisense; GCTTGCTGAACACTTTTACCCGTAA
>probe:Drosophila_2:1637678_at:285:555; Interrogation_Position=831; Antisense; GGACGAGTTCAAGCACATGGATCTA
>probe:Drosophila_2:1637678_at:484:107; Interrogation_Position=869; Antisense; AGAACATACAGCTGGTCTAGGCCCT
>probe:Drosophila_2:1637678_at:10:537; Interrogation_Position=882; Antisense; GGTCTAGGCCCTGCGATTTTAATCA

Paste this into a BLAST search page for me
TGCCCCACAAGAAGCTCACTGATATAAGAGGTCTCCCAGATTTGGCTGGAGATTCGAGTTTGTCATGCTCCAGTTTTTTGGCGTACCAGGTGCACCATGAGTGCACCATGAGAACGCTCCGGAGTTCCGGAGTGTCTCACAGTGGTTCACAGTGGTTCACTATACCGAGGTCCAACAAGGGTGTAGTTCTCATGCGCGGTTAAGGTACTCACAGCCCAGGAGGCTAGATGTTCTACCTGAAGCCCGACGAGCTTGCTGAACACTTTTACCCGTAAGGACGAGTTCAAGCACATGGATCTAAGAACATACAGCTGGTCTAGGCCCTGGTCTAGGCCCTGCGATTTTAATCA

Full Affymetrix probeset data:

Annotations for 1637678_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720