FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637681_at:

>probe:Drosophila_2:1637681_at:182:695; Interrogation_Position=1029; Antisense; TTTCCCCGCTCCAAGAATGCGTTAG
>probe:Drosophila_2:1637681_at:626:403; Interrogation_Position=1072; Antisense; GACTAGCTAGGCCTTTTCACGAAAA
>probe:Drosophila_2:1637681_at:359:145; Interrogation_Position=1122; Antisense; ACTAATTTCTCCAAGTGGCTGTCCC
>probe:Drosophila_2:1637681_at:565:373; Interrogation_Position=1164; Antisense; GAAGTATCCGTCAGCCATGTTGTAA
>probe:Drosophila_2:1637681_at:142:27; Interrogation_Position=1221; Antisense; ATAGCAGTGGACAACGCACCAGCGC
>probe:Drosophila_2:1637681_at:4:325; Interrogation_Position=1242; Antisense; GCGCACGACGAACGATTTCTGGGTT
>probe:Drosophila_2:1637681_at:459:473; Interrogation_Position=1271; Antisense; GTTCACCAGGAACTCCCAGGTTTAT
>probe:Drosophila_2:1637681_at:463:445; Interrogation_Position=1298; Antisense; GATGCACATTGCTGGCTATCAGTTC
>probe:Drosophila_2:1637681_at:547:693; Interrogation_Position=1330; Antisense; TTTCCCCTGTGTTTACCGGTCATTG
>probe:Drosophila_2:1637681_at:255:301; Interrogation_Position=1380; Antisense; CCCGCTTGGCGGGAGCAACAGAATA
>probe:Drosophila_2:1637681_at:371:325; Interrogation_Position=1407; Antisense; GCGAATCGCCGGAAGTTCGACGTTT
>probe:Drosophila_2:1637681_at:575:197; Interrogation_Position=1461; Antisense; AACGATCCACGCCTGCTGTTAAAGG
>probe:Drosophila_2:1637681_at:709:379; Interrogation_Position=947; Antisense; GAACCACTTCTTCAGGACAGCCAAT
>probe:Drosophila_2:1637681_at:572:373; Interrogation_Position=977; Antisense; GAAGAGTTGTGCCTACGTAATCCCC

Paste this into a BLAST search page for me
TTTCCCCGCTCCAAGAATGCGTTAGGACTAGCTAGGCCTTTTCACGAAAAACTAATTTCTCCAAGTGGCTGTCCCGAAGTATCCGTCAGCCATGTTGTAAATAGCAGTGGACAACGCACCAGCGCGCGCACGACGAACGATTTCTGGGTTGTTCACCAGGAACTCCCAGGTTTATGATGCACATTGCTGGCTATCAGTTCTTTCCCCTGTGTTTACCGGTCATTGCCCGCTTGGCGGGAGCAACAGAATAGCGAATCGCCGGAAGTTCGACGTTTAACGATCCACGCCTGCTGTTAAAGGGAACCACTTCTTCAGGACAGCCAATGAAGAGTTGTGCCTACGTAATCCCC

Full Affymetrix probeset data:

Annotations for 1637681_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720