FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637687_at:

>probe:Drosophila_2:1637687_at:51:601; Interrogation_Position=111; Antisense; TGTCAAAACTTGTCTCGTCTGTCTG
>probe:Drosophila_2:1637687_at:575:637; Interrogation_Position=125; Antisense; TCGTCTGTCTGCCATTAGCAGCAGC
>probe:Drosophila_2:1637687_at:719:329; Interrogation_Position=15; Antisense; GCGGGCGAATCTTTTTGGTAATACT
>probe:Drosophila_2:1637687_at:412:255; Interrogation_Position=246; Antisense; CAACATCTCGCCCACACAAAGTGGG
>probe:Drosophila_2:1637687_at:35:191; Interrogation_Position=280; Antisense; AACATCATCATGCTCATTACCAGAT
>probe:Drosophila_2:1637687_at:49:445; Interrogation_Position=302; Antisense; GATGATCATCAATTTGGGTTTACAA
>probe:Drosophila_2:1637687_at:165:665; Interrogation_Position=322; Antisense; TACAATAGACTTATCCTGGGACCAA
>probe:Drosophila_2:1637687_at:261:45; Interrogation_Position=334; Antisense; ATCCTGGGACCAAAAGAGTTAGCAC
>probe:Drosophila_2:1637687_at:494:429; Interrogation_Position=349; Antisense; GAGTTAGCACACGACTTGATTGCAG
>probe:Drosophila_2:1637687_at:167:403; Interrogation_Position=361; Antisense; GACTTGATTGCAGCTACTGTGCATG
>probe:Drosophila_2:1637687_at:113:341; Interrogation_Position=373; Antisense; GCTACTGTGCATGAAATGCTTCATT
>probe:Drosophila_2:1637687_at:508:641; Interrogation_Position=53; Antisense; TCTCATTCAGAATTCGTTGTTGGTG
>probe:Drosophila_2:1637687_at:527:721; Interrogation_Position=69; Antisense; TTGTTGGTGGTGCTGTCCTCTCCAT
>probe:Drosophila_2:1637687_at:192:643; Interrogation_Position=87; Antisense; TCTCCATCCTCCTGCAACAAAATAT

Paste this into a BLAST search page for me
TGTCAAAACTTGTCTCGTCTGTCTGTCGTCTGTCTGCCATTAGCAGCAGCGCGGGCGAATCTTTTTGGTAATACTCAACATCTCGCCCACACAAAGTGGGAACATCATCATGCTCATTACCAGATGATGATCATCAATTTGGGTTTACAATACAATAGACTTATCCTGGGACCAAATCCTGGGACCAAAAGAGTTAGCACGAGTTAGCACACGACTTGATTGCAGGACTTGATTGCAGCTACTGTGCATGGCTACTGTGCATGAAATGCTTCATTTCTCATTCAGAATTCGTTGTTGGTGTTGTTGGTGGTGCTGTCCTCTCCATTCTCCATCCTCCTGCAACAAAATAT

Full Affymetrix probeset data:

Annotations for 1637687_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720