FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637689_at:

>probe:Drosophila_2:1637689_at:358:177; Interrogation_Position=396; Antisense; AAACTGCTCTTCGTGATGCGCCATG
>probe:Drosophila_2:1637689_at:137:715; Interrogation_Position=435; Antisense; TTCGACAAGACCACCGCGGATATAT
>probe:Drosophila_2:1637689_at:229:459; Interrogation_Position=453; Antisense; GATATATTCCGAACCCTGCGCATGG
>probe:Drosophila_2:1637689_at:125:159; Interrogation_Position=487; Antisense; ACAACGCCGTCTTCATGGAGAACAC
>probe:Drosophila_2:1637689_at:92:423; Interrogation_Position=516; Antisense; GAGAACCAGTTGCTGCTGCGCGTTA
>probe:Drosophila_2:1637689_at:269:681; Interrogation_Position=539; Antisense; TATCGAACCCTTTGTAGTCTACGGC
>probe:Drosophila_2:1637689_at:439:159; Interrogation_Position=676; Antisense; ACAAGGGTGTCATCTGTCTGGAGGA
>probe:Drosophila_2:1637689_at:358:593; Interrogation_Position=724; Antisense; TGGGTCCAAACTTCGCCGCTGTAAA
>probe:Drosophila_2:1637689_at:56:665; Interrogation_Position=745; Antisense; TAAATGAGTTTCTGTGCGCCTTCAC
>probe:Drosophila_2:1637689_at:87:503; Interrogation_Position=773; Antisense; GTCCAGTCCCAGCAATGGTTGGCAA
>probe:Drosophila_2:1637689_at:215:91; Interrogation_Position=832; Antisense; AGTACGGCGATCGTGGCACTGCCAT
>probe:Drosophila_2:1637689_at:154:625; Interrogation_Position=876; Antisense; TGCCTGTAGAGACCCTAGCCTAGTA
>probe:Drosophila_2:1637689_at:668:1; Interrogation_Position=913; Antisense; ATTGTTCAACCTCTATAACCCATTC
>probe:Drosophila_2:1637689_at:667:657; Interrogation_Position=928; Antisense; TAACCCATTCTGTAGCTAAGCCCAA

Paste this into a BLAST search page for me
AAACTGCTCTTCGTGATGCGCCATGTTCGACAAGACCACCGCGGATATATGATATATTCCGAACCCTGCGCATGGACAACGCCGTCTTCATGGAGAACACGAGAACCAGTTGCTGCTGCGCGTTATATCGAACCCTTTGTAGTCTACGGCACAAGGGTGTCATCTGTCTGGAGGATGGGTCCAAACTTCGCCGCTGTAAATAAATGAGTTTCTGTGCGCCTTCACGTCCAGTCCCAGCAATGGTTGGCAAAGTACGGCGATCGTGGCACTGCCATTGCCTGTAGAGACCCTAGCCTAGTAATTGTTCAACCTCTATAACCCATTCTAACCCATTCTGTAGCTAAGCCCAA

Full Affymetrix probeset data:

Annotations for 1637689_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720