FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637690_at:

>probe:Drosophila_2:1637690_at:529:529; Interrogation_Position=1043; Antisense; GGGATCACCCTTCATTTAAGTCGAT
>probe:Drosophila_2:1637690_at:155:27; Interrogation_Position=1069; Antisense; ATAGATCATTGTATCGTGCCGCAAA
>probe:Drosophila_2:1637690_at:498:297; Interrogation_Position=1088; Antisense; CGCAAATCGATTTCAGGCTCCATTA
>probe:Drosophila_2:1637690_at:245:57; Interrogation_Position=527; Antisense; ATGATAGCTTGCACTCGAATGCCGC
>probe:Drosophila_2:1637690_at:652:233; Interrogation_Position=544; Antisense; AATGCCGCTCAATTCGTGGATGTGA
>probe:Drosophila_2:1637690_at:588:441; Interrogation_Position=562; Antisense; GATGTGATTCACACGGACTATCCCT
>probe:Drosophila_2:1637690_at:5:403; Interrogation_Position=577; Antisense; GACTATCCCTTGTTTGGCGACATTC
>probe:Drosophila_2:1637690_at:409:413; Interrogation_Position=602; Antisense; GACCTCGAGGAACTGTGGACTTCTA
>probe:Drosophila_2:1637690_at:304:723; Interrogation_Position=674; Antisense; TTGTTGCTGCCAGTAAGCTACTCCA
>probe:Drosophila_2:1637690_at:541:137; Interrogation_Position=698; Antisense; ACGAGGCTTATAGTTGCAGTCACAA
>probe:Drosophila_2:1637690_at:670:419; Interrogation_Position=725; Antisense; GAGCAGTCATGTTCTACGCTGAATC
>probe:Drosophila_2:1637690_at:714:419; Interrogation_Position=763; Antisense; GAGAATTTTCCAGCGGTTTCTTGCA
>probe:Drosophila_2:1637690_at:564:539; Interrogation_Position=777; Antisense; GGTTTCTTGCAGTTTAACGGCCATT
>probe:Drosophila_2:1637690_at:308:189; Interrogation_Position=944; Antisense; AACAGCTGGCTGTCGATCGGAAGTC

Paste this into a BLAST search page for me
GGGATCACCCTTCATTTAAGTCGATATAGATCATTGTATCGTGCCGCAAACGCAAATCGATTTCAGGCTCCATTAATGATAGCTTGCACTCGAATGCCGCAATGCCGCTCAATTCGTGGATGTGAGATGTGATTCACACGGACTATCCCTGACTATCCCTTGTTTGGCGACATTCGACCTCGAGGAACTGTGGACTTCTATTGTTGCTGCCAGTAAGCTACTCCAACGAGGCTTATAGTTGCAGTCACAAGAGCAGTCATGTTCTACGCTGAATCGAGAATTTTCCAGCGGTTTCTTGCAGGTTTCTTGCAGTTTAACGGCCATTAACAGCTGGCTGTCGATCGGAAGTC

Full Affymetrix probeset data:

Annotations for 1637690_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720