FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637691_at:

>probe:Drosophila_2:1637691_at:129:455; Interrogation_Position=1047; Antisense; GATCAGACCGAGTTCTGCTAGCCAA
>probe:Drosophila_2:1637691_at:89:619; Interrogation_Position=1062; Antisense; TGCTAGCCAAGCTGTGGATTCCAAT
>probe:Drosophila_2:1637691_at:97:237; Interrogation_Position=1084; Antisense; AATCGCACCCTGATTCTTGAATGTT
>probe:Drosophila_2:1637691_at:383:665; Interrogation_Position=1188; Antisense; TACACTCTGATTAGATTCGCGGCGT
>probe:Drosophila_2:1637691_at:13:271; Interrogation_Position=723; Antisense; CATCAGGATTGGACCGTGCGCGACT
>probe:Drosophila_2:1637691_at:199:407; Interrogation_Position=744; Antisense; GACTGGCGCAACATCTTCAACATGG
>probe:Drosophila_2:1637691_at:88:77; Interrogation_Position=805; Antisense; AGGAGATCTTCCTTGACTCGCTGAT
>probe:Drosophila_2:1637691_at:610:525; Interrogation_Position=839; Antisense; GGGCAGTGTCTGCAATGACCTCAAT
>probe:Drosophila_2:1637691_at:457:39; Interrogation_Position=862; Antisense; ATCTCCTCGAGCAATTGATGGCCAT
>probe:Drosophila_2:1637691_at:215:607; Interrogation_Position=877; Antisense; TGATGGCCATCATCCAGCCGAGGAT
>probe:Drosophila_2:1637691_at:10:73; Interrogation_Position=897; Antisense; AGGATTCAGAATCAGGCGCCCAAAA
>probe:Drosophila_2:1637691_at:171:221; Interrogation_Position=921; Antisense; AATGTCAGCGAGTTTCGAGCCGTCT
>probe:Drosophila_2:1637691_at:583:645; Interrogation_Position=943; Antisense; TCTTGTACGACGTCTGGCACAGCGA
>probe:Drosophila_2:1637691_at:394:427; Interrogation_Position=990; Antisense; GAGATGCTCTACGAGTCGATGACGT

Paste this into a BLAST search page for me
GATCAGACCGAGTTCTGCTAGCCAATGCTAGCCAAGCTGTGGATTCCAATAATCGCACCCTGATTCTTGAATGTTTACACTCTGATTAGATTCGCGGCGTCATCAGGATTGGACCGTGCGCGACTGACTGGCGCAACATCTTCAACATGGAGGAGATCTTCCTTGACTCGCTGATGGGCAGTGTCTGCAATGACCTCAATATCTCCTCGAGCAATTGATGGCCATTGATGGCCATCATCCAGCCGAGGATAGGATTCAGAATCAGGCGCCCAAAAAATGTCAGCGAGTTTCGAGCCGTCTTCTTGTACGACGTCTGGCACAGCGAGAGATGCTCTACGAGTCGATGACGT

Full Affymetrix probeset data:

Annotations for 1637691_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720