FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637693_at:

>probe:Drosophila_2:1637693_at:503:707; Interrogation_Position=1018; Antisense; TTACCGCATTTATTGCACTGCTGTC
>probe:Drosophila_2:1637693_at:589:521; Interrogation_Position=1057; Antisense; GGGCCACACGTTCCACGCTTTTGGG
>probe:Drosophila_2:1637693_at:601:359; Interrogation_Position=1173; Antisense; GCAAGAATCAGGGTTGTTGCTCTGA
>probe:Drosophila_2:1637693_at:144:469; Interrogation_Position=1188; Antisense; GTTGCTCTGAGGTGGTAGACTTCTT
>probe:Drosophila_2:1637693_at:528:485; Interrogation_Position=1202; Antisense; GTAGACTTCTTCCTGAACAAGGGCA
>probe:Drosophila_2:1637693_at:630:525; Interrogation_Position=1222; Antisense; GGGCAAGCGCACATGTTGAGCTGAA
>probe:Drosophila_2:1637693_at:39:455; Interrogation_Position=1283; Antisense; GATAATATTTTCAGGCAGCAGCCGC
>probe:Drosophila_2:1637693_at:595:71; Interrogation_Position=1295; Antisense; AGGCAGCAGCCGCATTAGCTTTCGC
>probe:Drosophila_2:1637693_at:283:599; Interrogation_Position=753; Antisense; TGTCTGCGCTCATCCAATTTCACTG
>probe:Drosophila_2:1637693_at:594:47; Interrogation_Position=764; Antisense; ATCCAATTTCACTGGCCACAATAAC
>probe:Drosophila_2:1637693_at:182:653; Interrogation_Position=795; Antisense; TAATGTAAGGTAGACGCCGACGGCA
>probe:Drosophila_2:1637693_at:463:171; Interrogation_Position=819; Antisense; AAAGAGCAGAGCAGCCAGTCCCAGA
>probe:Drosophila_2:1637693_at:141:265; Interrogation_Position=840; Antisense; CAGAGCCTTGGGTCCGCGATTGTTT
>probe:Drosophila_2:1637693_at:87:127; Interrogation_Position=903; Antisense; ACCACCGCCATTGGGAGCATTTCTG

Paste this into a BLAST search page for me
TTACCGCATTTATTGCACTGCTGTCGGGCCACACGTTCCACGCTTTTGGGGCAAGAATCAGGGTTGTTGCTCTGAGTTGCTCTGAGGTGGTAGACTTCTTGTAGACTTCTTCCTGAACAAGGGCAGGGCAAGCGCACATGTTGAGCTGAAGATAATATTTTCAGGCAGCAGCCGCAGGCAGCAGCCGCATTAGCTTTCGCTGTCTGCGCTCATCCAATTTCACTGATCCAATTTCACTGGCCACAATAACTAATGTAAGGTAGACGCCGACGGCAAAAGAGCAGAGCAGCCAGTCCCAGACAGAGCCTTGGGTCCGCGATTGTTTACCACCGCCATTGGGAGCATTTCTG

Full Affymetrix probeset data:

Annotations for 1637693_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720