FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637698_at:

>probe:Drosophila_2:1637698_at:586:425; Interrogation_Position=1065; Antisense; GAGAGCGACGCGACAGATGGCCAAA
>probe:Drosophila_2:1637698_at:328:117; Interrogation_Position=1103; Antisense; AGCTTTTAGCGAGCACTATCTGTGA
>probe:Drosophila_2:1637698_at:274:611; Interrogation_Position=1199; Antisense; TGACGAACGCTTAGGCAGTTCCTCT
>probe:Drosophila_2:1637698_at:167:351; Interrogation_Position=1213; Antisense; GCAGTTCCTCTGCAAAAGGCGTCGA
>probe:Drosophila_2:1637698_at:493:167; Interrogation_Position=1227; Antisense; AAAGGCGTCGAAGCAGGAATCCAAC
>probe:Drosophila_2:1637698_at:144:367; Interrogation_Position=1243; Antisense; GAATCCAACGGAATGGCTTCGGTTT
>probe:Drosophila_2:1637698_at:534:639; Interrogation_Position=1261; Antisense; TCGGTTTCCAGCAGCGACGATGTTA
>probe:Drosophila_2:1637698_at:584:309; Interrogation_Position=716; Antisense; CCAGCAGCGGTTTCACGTGTATAAA
>probe:Drosophila_2:1637698_at:503:133; Interrogation_Position=770; Antisense; ACGCGAATACCTGCCGGAAGAATAT
>probe:Drosophila_2:1637698_at:130:397; Interrogation_Position=842; Antisense; GAAATTGCTGTCCTATGAGAGCTAT
>probe:Drosophila_2:1637698_at:510:419; Interrogation_Position=860; Antisense; GAGCTATTTTGCTGAGGATTCCCAG
>probe:Drosophila_2:1637698_at:324:119; Interrogation_Position=901; Antisense; AGCTGCGGCCTGGAAAGCGTGTTAA
>probe:Drosophila_2:1637698_at:351:243; Interrogation_Position=935; Antisense; AATTTTTGGCGCTGAGGGATCCTTC
>probe:Drosophila_2:1637698_at:192:529; Interrogation_Position=950; Antisense; GGGATCCTTCCGAAAACTCGACATC

Paste this into a BLAST search page for me
GAGAGCGACGCGACAGATGGCCAAAAGCTTTTAGCGAGCACTATCTGTGATGACGAACGCTTAGGCAGTTCCTCTGCAGTTCCTCTGCAAAAGGCGTCGAAAAGGCGTCGAAGCAGGAATCCAACGAATCCAACGGAATGGCTTCGGTTTTCGGTTTCCAGCAGCGACGATGTTACCAGCAGCGGTTTCACGTGTATAAAACGCGAATACCTGCCGGAAGAATATGAAATTGCTGTCCTATGAGAGCTATGAGCTATTTTGCTGAGGATTCCCAGAGCTGCGGCCTGGAAAGCGTGTTAAAATTTTTGGCGCTGAGGGATCCTTCGGGATCCTTCCGAAAACTCGACATC

Full Affymetrix probeset data:

Annotations for 1637698_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720