FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637701_at:

>probe:Drosophila_2:1637701_at:209:555; Interrogation_Position=193; Antisense; GGACGCTACGTGCACATGGACAACA
>probe:Drosophila_2:1637701_at:684:489; Interrogation_Position=219; Antisense; GTACAAGCACGACGATCGTCCTGGT
>probe:Drosophila_2:1637701_at:682:13; Interrogation_Position=248; Antisense; ATTACTCCGGCGATGCAGGTCGCTA
>probe:Drosophila_2:1637701_at:178:351; Interrogation_Position=358; Antisense; GCAGCAGTTGTAGTGCCCAGAACCT
>probe:Drosophila_2:1637701_at:298:571; Interrogation_Position=423; Antisense; GGCTATTGCCGATCCAACTGCCAAT
>probe:Drosophila_2:1637701_at:425:193; Interrogation_Position=438; Antisense; AACTGCCAATCTTCCCAAGGGACGT
>probe:Drosophila_2:1637701_at:698:441; Interrogation_Position=485; Antisense; GATGGGCCATCATCCGCCAGGAAGA
>probe:Drosophila_2:1637701_at:234:547; Interrogation_Position=522; Antisense; GGATGGCTATCACTATCTTTGGGAA
>probe:Drosophila_2:1637701_at:433:195; Interrogation_Position=546; Antisense; AACTGAGAACGGCATCTTAGGCGAG
>probe:Drosophila_2:1637701_at:292:423; Interrogation_Position=604; Antisense; GAGGGACTTCGTTCCAAGGGATTCT
>probe:Drosophila_2:1637701_at:453:463; Interrogation_Position=623; Antisense; GATTCTACGAGTACACTGGACCCGA
>probe:Drosophila_2:1637701_at:476:47; Interrogation_Position=652; Antisense; ATCCTCTACCGCGTGGACTATGTAG
>probe:Drosophila_2:1637701_at:49:115; Interrogation_Position=675; Antisense; AGCAGACGACAATGGCTTTGTGCCA
>probe:Drosophila_2:1637701_at:514:475; Interrogation_Position=750; Antisense; GTTACTCGCCTTTTTGGAAGCAAAT

Paste this into a BLAST search page for me
GGACGCTACGTGCACATGGACAACAGTACAAGCACGACGATCGTCCTGGTATTACTCCGGCGATGCAGGTCGCTAGCAGCAGTTGTAGTGCCCAGAACCTGGCTATTGCCGATCCAACTGCCAATAACTGCCAATCTTCCCAAGGGACGTGATGGGCCATCATCCGCCAGGAAGAGGATGGCTATCACTATCTTTGGGAAAACTGAGAACGGCATCTTAGGCGAGGAGGGACTTCGTTCCAAGGGATTCTGATTCTACGAGTACACTGGACCCGAATCCTCTACCGCGTGGACTATGTAGAGCAGACGACAATGGCTTTGTGCCAGTTACTCGCCTTTTTGGAAGCAAAT

Full Affymetrix probeset data:

Annotations for 1637701_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720