Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637705_at:

>probe:Drosophila_2:1637705_at:522:657; Interrogation_Position=3458; Antisense; TAAGAGCGCGAATCAAACCAAATAT
>probe:Drosophila_2:1637705_at:453:669; Interrogation_Position=3505; Antisense; TACGATAGTTTTAGCCTGTAGGTAT
>probe:Drosophila_2:1637705_at:656:177; Interrogation_Position=3536; Antisense; AAACAGGGATCAGCCAGCCTACAGT
>probe:Drosophila_2:1637705_at:646:125; Interrogation_Position=3547; Antisense; AGCCAGCCTACAGTTAGACGTACCT
>probe:Drosophila_2:1637705_at:580:675; Interrogation_Position=3561; Antisense; TAGACGTACCTGTAACCCCGTGAGT
>probe:Drosophila_2:1637705_at:439:511; Interrogation_Position=3580; Antisense; GTGAGTTCTCGCTCCATACCACTTT
>probe:Drosophila_2:1637705_at:98:271; Interrogation_Position=3594; Antisense; CATACCACTTTTTTAGCCACCATGT
>probe:Drosophila_2:1637705_at:247:675; Interrogation_Position=3607; Antisense; TAGCCACCATGTAATCTTTTAATGT
>probe:Drosophila_2:1637705_at:32:689; Interrogation_Position=3715; Antisense; TATATTCTCCTGAAAGTGGATCCAA
>probe:Drosophila_2:1637705_at:29:279; Interrogation_Position=3764; Antisense; CTATTTTCTTTATTGTTCTTGTGTT
>probe:Drosophila_2:1637705_at:359:705; Interrogation_Position=3810; Antisense; TTACCGTTATTATTGTGTTTACATG
>probe:Drosophila_2:1637705_at:352:605; Interrogation_Position=3837; Antisense; TGATTTTCATATCGCATTATCGCAA
>probe:Drosophila_2:1637705_at:433:355; Interrogation_Position=3858; Antisense; GCAATTTGAATTGTTTTAGCCCAAA
>probe:Drosophila_2:1637705_at:707:239; Interrogation_Position=3892; Antisense; AATCAAGCCAAGTCAATTGCAAAAG

Paste this into a BLAST search page for me
TAAGAGCGCGAATCAAACCAAATATTACGATAGTTTTAGCCTGTAGGTATAAACAGGGATCAGCCAGCCTACAGTAGCCAGCCTACAGTTAGACGTACCTTAGACGTACCTGTAACCCCGTGAGTGTGAGTTCTCGCTCCATACCACTTTCATACCACTTTTTTAGCCACCATGTTAGCCACCATGTAATCTTTTAATGTTATATTCTCCTGAAAGTGGATCCAACTATTTTCTTTATTGTTCTTGTGTTTTACCGTTATTATTGTGTTTACATGTGATTTTCATATCGCATTATCGCAAGCAATTTGAATTGTTTTAGCCCAAAAATCAAGCCAAGTCAATTGCAAAAG

Full Affymetrix probeset data:

Annotations for 1637705_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime