FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637706_at:

>probe:Drosophila_2:1637706_at:134:455; Interrogation_Position=415; Antisense; GATACTGGGTGAGTTCGGACCCCAA
>probe:Drosophila_2:1637706_at:628:203; Interrogation_Position=438; Antisense; AAGCCTGCATCCTGGAGGAGCCGTG
>probe:Drosophila_2:1637706_at:510:513; Interrogation_Position=465; Antisense; GTGTCCATGCCTCTAGATACTCAGG
>probe:Drosophila_2:1637706_at:158:29; Interrogation_Position=481; Antisense; ATACTCAGGCAGTTCTGATGGCCGC
>probe:Drosophila_2:1637706_at:490:607; Interrogation_Position=496; Antisense; TGATGGCCGCTTTCCTGATGGAAAA
>probe:Drosophila_2:1637706_at:409:173; Interrogation_Position=523; Antisense; AAAGCCACATGCTGCCTGGTCGGAA
>probe:Drosophila_2:1637706_at:371:209; Interrogation_Position=590; Antisense; AAGCAATGGTACCTTCTATCCCTGT
>probe:Drosophila_2:1637706_at:574:179; Interrogation_Position=662; Antisense; AAAAGGATGCCGTGTCCAGGAGTCG
>probe:Drosophila_2:1637706_at:381:613; Interrogation_Position=713; Antisense; TGAAGATCTGAACGGATCCGCCTCC
>probe:Drosophila_2:1637706_at:582:441; Interrogation_Position=778; Antisense; GATGGAGTCCCCTTAGTCAGTCGCA
>probe:Drosophila_2:1637706_at:494:501; Interrogation_Position=797; Antisense; GTCGCATCGGACATCTTTGTTAATC
>probe:Drosophila_2:1637706_at:492:693; Interrogation_Position=812; Antisense; TTTGTTAATCATCCATCTCTCGGCA
>probe:Drosophila_2:1637706_at:476:119; Interrogation_Position=846; Antisense; AGCTGCCATGTGCTGTCCTTGTACA
>probe:Drosophila_2:1637706_at:158:505; Interrogation_Position=860; Antisense; GTCCTTGTACACCACATCATTTTGT

Paste this into a BLAST search page for me
GATACTGGGTGAGTTCGGACCCCAAAAGCCTGCATCCTGGAGGAGCCGTGGTGTCCATGCCTCTAGATACTCAGGATACTCAGGCAGTTCTGATGGCCGCTGATGGCCGCTTTCCTGATGGAAAAAAAGCCACATGCTGCCTGGTCGGAAAAGCAATGGTACCTTCTATCCCTGTAAAAGGATGCCGTGTCCAGGAGTCGTGAAGATCTGAACGGATCCGCCTCCGATGGAGTCCCCTTAGTCAGTCGCAGTCGCATCGGACATCTTTGTTAATCTTTGTTAATCATCCATCTCTCGGCAAGCTGCCATGTGCTGTCCTTGTACAGTCCTTGTACACCACATCATTTTGT

Full Affymetrix probeset data:

Annotations for 1637706_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720