Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637707_at:

>probe:Drosophila_2:1637707_at:706:423; Interrogation_Position=1303; Antisense; GAGACTATTCGTTTACTGGACACAT
>probe:Drosophila_2:1637707_at:726:395; Interrogation_Position=1330; Antisense; GACAACTTCGATGCCCTGTTGAGAG
>probe:Drosophila_2:1637707_at:284:729; Interrogation_Position=1357; Antisense; TTGGCTACCCAGTTGCACAAGCGAT
>probe:Drosophila_2:1637707_at:599:423; Interrogation_Position=1481; Antisense; GAGACTTCGGATTGGCTTCCTACAA
>probe:Drosophila_2:1637707_at:458:465; Interrogation_Position=1543; Antisense; GATTGGGCGGATTTCGCTCACGAAA
>probe:Drosophila_2:1637707_at:504:185; Interrogation_Position=1579; Antisense; AAAATATCGCTGTTGCGCCGACTGT
>probe:Drosophila_2:1637707_at:666:673; Interrogation_Position=1641; Antisense; TACCTTGGAGTACCATGTCCCAGAT
>probe:Drosophila_2:1637707_at:281:265; Interrogation_Position=1661; Antisense; CAGATGCTCTATTCGGACCAACTTT
>probe:Drosophila_2:1637707_at:260:189; Interrogation_Position=1703; Antisense; AACAGTTCCTTAACACGCGACGTGG
>probe:Drosophila_2:1637707_at:121:325; Interrogation_Position=1719; Antisense; GCGACGTGGCGATAGATTCTTCTTT
>probe:Drosophila_2:1637707_at:345:369; Interrogation_Position=1756; Antisense; GAAGGAGGTTTTTCGCGCGCTCAAT
>probe:Drosophila_2:1637707_at:246:393; Interrogation_Position=1794; Antisense; GAAAGTGAGCCTGTCCAGCTTGTTC
>probe:Drosophila_2:1637707_at:165:343; Interrogation_Position=1811; Antisense; GCTTGTTCTGCAGCAATGCCAACTA
>probe:Drosophila_2:1637707_at:211:309; Interrogation_Position=1851; Antisense; GCCAAACGTATTTGTCTTCCCGAAT

Paste this into a BLAST search page for me
GAGACTATTCGTTTACTGGACACATGACAACTTCGATGCCCTGTTGAGAGTTGGCTACCCAGTTGCACAAGCGATGAGACTTCGGATTGGCTTCCTACAAGATTGGGCGGATTTCGCTCACGAAAAAAATATCGCTGTTGCGCCGACTGTTACCTTGGAGTACCATGTCCCAGATCAGATGCTCTATTCGGACCAACTTTAACAGTTCCTTAACACGCGACGTGGGCGACGTGGCGATAGATTCTTCTTTGAAGGAGGTTTTTCGCGCGCTCAATGAAAGTGAGCCTGTCCAGCTTGTTCGCTTGTTCTGCAGCAATGCCAACTAGCCAAACGTATTTGTCTTCCCGAAT

Full Affymetrix probeset data:

Annotations for 1637707_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime