Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637708_a_at:

>probe:Drosophila_2:1637708_a_at:205:235; Interrogation_Position=214; Antisense; AATCCTCTGAGTGCGATGTGGTCCG
>probe:Drosophila_2:1637708_a_at:414:591; Interrogation_Position=232; Antisense; TGGTCCGCGGCGAGTGTACGCAAAC
>probe:Drosophila_2:1637708_a_at:141:601; Interrogation_Position=246; Antisense; TGTACGCAAACCTATGTGCCCTACC
>probe:Drosophila_2:1637708_a_at:200:61; Interrogation_Position=259; Antisense; ATGTGCCCTACCTGTTCCTGGTCAT
>probe:Drosophila_2:1637708_a_at:679:531; Interrogation_Position=296; Antisense; GGTGACGCTGACTGGCCAGGATTAC
>probe:Drosophila_2:1637708_a_at:269:103; Interrogation_Position=331; Antisense; AGAGCGGATGCGTGTGCAAGCCCAA
>probe:Drosophila_2:1637708_a_at:445:319; Interrogation_Position=372; Antisense; GCCCAGGAGCCGAACATGATACCGT
>probe:Drosophila_2:1637708_a_at:396:325; Interrogation_Position=418; Antisense; GCGAAGGCGGTAACCACCAGGAACA
>probe:Drosophila_2:1637708_a_at:224:415; Interrogation_Position=491; Antisense; GAGCCAAGCCGAGCTGGGCTGAACT
>probe:Drosophila_2:1637708_a_at:68:287; Interrogation_Position=522; Antisense; CTGGCTGGCTGGCTTAATTAAAAGG
>probe:Drosophila_2:1637708_a_at:141:39; Interrogation_Position=601; Antisense; ATCTCTCATTCTCCTTTAAATCCCA
>probe:Drosophila_2:1637708_a_at:635:235; Interrogation_Position=619; Antisense; AATCCCACTCAGCTTTATAAAATTG
>probe:Drosophila_2:1637708_a_at:376:235; Interrogation_Position=667; Antisense; AATCGAATCCTAATGTTAAGTCTAA
>probe:Drosophila_2:1637708_a_at:352:663; Interrogation_Position=709; Antisense; TAAATGCCTCTGTGCGTTTGTAGTG

Paste this into a BLAST search page for me
AATCCTCTGAGTGCGATGTGGTCCGTGGTCCGCGGCGAGTGTACGCAAACTGTACGCAAACCTATGTGCCCTACCATGTGCCCTACCTGTTCCTGGTCATGGTGACGCTGACTGGCCAGGATTACAGAGCGGATGCGTGTGCAAGCCCAAGCCCAGGAGCCGAACATGATACCGTGCGAAGGCGGTAACCACCAGGAACAGAGCCAAGCCGAGCTGGGCTGAACTCTGGCTGGCTGGCTTAATTAAAAGGATCTCTCATTCTCCTTTAAATCCCAAATCCCACTCAGCTTTATAAAATTGAATCGAATCCTAATGTTAAGTCTAATAAATGCCTCTGTGCGTTTGTAGTG

Full Affymetrix probeset data:

Annotations for 1637708_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime