Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637709_at:

>probe:Drosophila_2:1637709_at:56:375; Interrogation_Position=2080; Antisense; GAAGATTACGAATTTCCAGCCCTAG
>probe:Drosophila_2:1637709_at:279:263; Interrogation_Position=2123; Antisense; CAGCGGCTCCGACTTGTAAGCTAAA
>probe:Drosophila_2:1637709_at:585:485; Interrogation_Position=2138; Antisense; GTAAGCTAAAGGATCCGCCCAAGAA
>probe:Drosophila_2:1637709_at:510:659; Interrogation_Position=2199; Antisense; TAAGCCCAAGAAAGTCTGTCCACCT
>probe:Drosophila_2:1637709_at:678:507; Interrogation_Position=2244; Antisense; GTGCGAGATCTGTCACTTCATGGAT
>probe:Drosophila_2:1637709_at:674:543; Interrogation_Position=2265; Antisense; GGATCGCCCTTTCAACGAACAGGAG
>probe:Drosophila_2:1637709_at:28:155; Interrogation_Position=2283; Antisense; ACAGGAGGCTCCCTTCATGCGGGAA
>probe:Drosophila_2:1637709_at:135:109; Interrogation_Position=2324; Antisense; AGAAGCGCCAGCTGCGTGCCTATTA
>probe:Drosophila_2:1637709_at:181:55; Interrogation_Position=2385; Antisense; ATGCAAGACAGAGTACCGGGCGCCC
>probe:Drosophila_2:1637709_at:223:71; Interrogation_Position=2410; Antisense; AGGCACCAATGCGATCCGATCTACT
>probe:Drosophila_2:1637709_at:724:619; Interrogation_Position=2434; Antisense; TGCTCCAACTTCTTGTGCCAAAATC
>probe:Drosophila_2:1637709_at:299:113; Interrogation_Position=2471; Antisense; AGCACTGCGATTGCCTGGGAGCCGT
>probe:Drosophila_2:1637709_at:610:125; Interrogation_Position=2490; Antisense; AGCCGTCCAGGAGCTGCAGAATCTT
>probe:Drosophila_2:1637709_at:659:421; Interrogation_Position=2566; Antisense; GAGAATCTCCGGAAACGCGTTTGCC

Paste this into a BLAST search page for me
GAAGATTACGAATTTCCAGCCCTAGCAGCGGCTCCGACTTGTAAGCTAAAGTAAGCTAAAGGATCCGCCCAAGAATAAGCCCAAGAAAGTCTGTCCACCTGTGCGAGATCTGTCACTTCATGGATGGATCGCCCTTTCAACGAACAGGAGACAGGAGGCTCCCTTCATGCGGGAAAGAAGCGCCAGCTGCGTGCCTATTAATGCAAGACAGAGTACCGGGCGCCCAGGCACCAATGCGATCCGATCTACTTGCTCCAACTTCTTGTGCCAAAATCAGCACTGCGATTGCCTGGGAGCCGTAGCCGTCCAGGAGCTGCAGAATCTTGAGAATCTCCGGAAACGCGTTTGCC

Full Affymetrix probeset data:

Annotations for 1637709_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime