Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637710_at:

>probe:Drosophila_2:1637710_at:628:113; Interrogation_Position=12149; Antisense; AGCTTCTCCCGTGTTTCAGCGGAGA
>probe:Drosophila_2:1637710_at:379:515; Interrogation_Position=12159; Antisense; GTGTTTCAGCGGAGAGTTCCAGCGA
>probe:Drosophila_2:1637710_at:88:95; Interrogation_Position=12173; Antisense; AGTTCCAGCGAAAGCGAGGCCCAGT
>probe:Drosophila_2:1637710_at:218:439; Interrogation_Position=12188; Antisense; GAGGCCCAGTCGATATCATCCGTGT
>probe:Drosophila_2:1637710_at:486:353; Interrogation_Position=12252; Antisense; GCAGCGGCATGTTCCGAATCTTCGG
>probe:Drosophila_2:1637710_at:153:231; Interrogation_Position=12268; Antisense; AATCTTCGGCCGCAAGGGCGACAAG
>probe:Drosophila_2:1637710_at:671:73; Interrogation_Position=12303; Antisense; AGGACAAGGACAAGCGCCGCTCGAG
>probe:Drosophila_2:1637710_at:541:653; Interrogation_Position=12328; Antisense; TCAAGTCCCGCCACAGTGAGAACAT
>probe:Drosophila_2:1637710_at:315:371; Interrogation_Position=12373; Antisense; GAAGGAGCGCCACCGTTACAACAGA
>probe:Drosophila_2:1637710_at:339:709; Interrogation_Position=12388; Antisense; TTACAACAGATGAACCAGGCCGAAT
>probe:Drosophila_2:1637710_at:343:611; Interrogation_Position=12398; Antisense; TGAACCAGGCCGAATTGTTTTTTGT
>probe:Drosophila_2:1637710_at:372:61; Interrogation_Position=12445; Antisense; ATGTCATTTGTATTCGCCAAGGGCA
>probe:Drosophila_2:1637710_at:721:713; Interrogation_Position=12457; Antisense; TTCGCCAAGGGCAATCAAATTTAAA
>probe:Drosophila_2:1637710_at:107:483; Interrogation_Position=12622; Antisense; GTATCTGTAAGTTTGTTCGTTGTAT

Paste this into a BLAST search page for me
AGCTTCTCCCGTGTTTCAGCGGAGAGTGTTTCAGCGGAGAGTTCCAGCGAAGTTCCAGCGAAAGCGAGGCCCAGTGAGGCCCAGTCGATATCATCCGTGTGCAGCGGCATGTTCCGAATCTTCGGAATCTTCGGCCGCAAGGGCGACAAGAGGACAAGGACAAGCGCCGCTCGAGTCAAGTCCCGCCACAGTGAGAACATGAAGGAGCGCCACCGTTACAACAGATTACAACAGATGAACCAGGCCGAATTGAACCAGGCCGAATTGTTTTTTGTATGTCATTTGTATTCGCCAAGGGCATTCGCCAAGGGCAATCAAATTTAAAGTATCTGTAAGTTTGTTCGTTGTAT

Full Affymetrix probeset data:

Annotations for 1637710_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime