Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637711_at:

>probe:Drosophila_2:1637711_at:153:569; Interrogation_Position=1018; Antisense; GGCATTCTAACGATCGGAGGCTTTA
>probe:Drosophila_2:1637711_at:72:549; Interrogation_Position=1033; Antisense; GGAGGCTTTATACTGACCAACGTCT
>probe:Drosophila_2:1637711_at:583:647; Interrogation_Position=1082; Antisense; TCACATCCGGGCTGTACGACGAGGA
>probe:Drosophila_2:1637711_at:709:381; Interrogation_Position=1201; Antisense; GAACGGCTCCGCAGGAACAGCTTGA
>probe:Drosophila_2:1637711_at:346:225; Interrogation_Position=1246; Antisense; AAGGCGTACCGGGATGGGCTCAATC
>probe:Drosophila_2:1637711_at:183:667; Interrogation_Position=1282; Antisense; TACATATTGTACGAGGACCGCCTGG
>probe:Drosophila_2:1637711_at:503:711; Interrogation_Position=1348; Antisense; TTCAACATGATTCGCCAGGCCGTGG
>probe:Drosophila_2:1637711_at:130:285; Interrogation_Position=1370; Antisense; TGGGTTTTACCCTCGAATCCTACTG
>probe:Drosophila_2:1637711_at:430:189; Interrogation_Position=1402; Antisense; AACAGTCTGCCGTACTTGGCGATGA
>probe:Drosophila_2:1637711_at:720:609; Interrogation_Position=1424; Antisense; TGACCAGTGAGTTCATGAGGCGCCT
>probe:Drosophila_2:1637711_at:514:225; Interrogation_Position=1477; Antisense; AAGGCGGACACTTTCCGGGAGCTCA
>probe:Drosophila_2:1637711_at:671:527; Interrogation_Position=1493; Antisense; GGGAGCTCATCCATCAGGGAATCTA
>probe:Drosophila_2:1637711_at:29:527; Interrogation_Position=1509; Antisense; GGGAATCTATACCTTGATGCGCGAT
>probe:Drosophila_2:1637711_at:425:411; Interrogation_Position=1558; Antisense; GACCTGGACTACTACTTTTTCGCAT

Paste this into a BLAST search page for me
GGCATTCTAACGATCGGAGGCTTTAGGAGGCTTTATACTGACCAACGTCTTCACATCCGGGCTGTACGACGAGGAGAACGGCTCCGCAGGAACAGCTTGAAAGGCGTACCGGGATGGGCTCAATCTACATATTGTACGAGGACCGCCTGGTTCAACATGATTCGCCAGGCCGTGGTGGGTTTTACCCTCGAATCCTACTGAACAGTCTGCCGTACTTGGCGATGATGACCAGTGAGTTCATGAGGCGCCTAAGGCGGACACTTTCCGGGAGCTCAGGGAGCTCATCCATCAGGGAATCTAGGGAATCTATACCTTGATGCGCGATGACCTGGACTACTACTTTTTCGCAT

Full Affymetrix probeset data:

Annotations for 1637711_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime