FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637712_at:

>probe:Drosophila_2:1637712_at:67:49; Interrogation_Position=5182; Antisense; ATCCTCTCCTCAAAGCAGCGTTATA
>probe:Drosophila_2:1637712_at:716:475; Interrogation_Position=5201; Antisense; GTTATATACCGCGATCTTGAGCTAT
>probe:Drosophila_2:1637712_at:428:417; Interrogation_Position=5219; Antisense; GAGCTATTCAGTTTCTATAAATCGC
>probe:Drosophila_2:1637712_at:327:375; Interrogation_Position=5263; Antisense; TAAGTACCGGATCGAAGGACCTCTA
>probe:Drosophila_2:1637712_at:533:521; Interrogation_Position=5292; Antisense; GGGCCACTTATCAGAAGGCGTTGGT
>probe:Drosophila_2:1637712_at:686:643; Interrogation_Position=5379; Antisense; TCTCATCCACATTGCGATCTGATCT
>probe:Drosophila_2:1637712_at:529:623; Interrogation_Position=5391; Antisense; TGCGATCTGATCTGGAGCTGGTGCT
>probe:Drosophila_2:1637712_at:291:665; Interrogation_Position=5438; Antisense; TACAAACGCAGCTGGCCGGCACATA
>probe:Drosophila_2:1637712_at:109:357; Interrogation_Position=5456; Antisense; GCACATACGGATGCCACAGTGGACT
>probe:Drosophila_2:1637712_at:500:251; Interrogation_Position=5470; Antisense; CACAGTGGACTTTCGCAAACGGGTT
>probe:Drosophila_2:1637712_at:340:705; Interrogation_Position=5505; Antisense; TTATGAACTTAAGCCCGAGATTCGC
>probe:Drosophila_2:1637712_at:270:1; Interrogation_Position=5528; Antisense; GCGCCCTTTTCCATTAAGTTCGATA
>probe:Drosophila_2:1637712_at:394:529; Interrogation_Position=5569; Antisense; GGGTACCTGCATCGAAGCCAATGTG
>probe:Drosophila_2:1637712_at:590:1; Interrogation_Position=5605; Antisense; ATTGGACCAACGAGACACTACCTTC

Paste this into a BLAST search page for me
ATCCTCTCCTCAAAGCAGCGTTATAGTTATATACCGCGATCTTGAGCTATGAGCTATTCAGTTTCTATAAATCGCTAAGTACCGGATCGAAGGACCTCTAGGGCCACTTATCAGAAGGCGTTGGTTCTCATCCACATTGCGATCTGATCTTGCGATCTGATCTGGAGCTGGTGCTTACAAACGCAGCTGGCCGGCACATAGCACATACGGATGCCACAGTGGACTCACAGTGGACTTTCGCAAACGGGTTTTATGAACTTAAGCCCGAGATTCGCGCGCCCTTTTCCATTAAGTTCGATAGGGTACCTGCATCGAAGCCAATGTGATTGGACCAACGAGACACTACCTTC

Full Affymetrix probeset data:

Annotations for 1637712_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720