FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637713_at:

>probe:Drosophila_2:1637713_at:449:73; Interrogation_Position=1044; Antisense; AGGCAAGGAGCAGTTACCGCACACC
>probe:Drosophila_2:1637713_at:426:413; Interrogation_Position=1077; Antisense; GACCACTTTTGGATAGCTTGACTCA
>probe:Drosophila_2:1637713_at:579:51; Interrogation_Position=1106; Antisense; ATGCGGGATATCACTGGCCTACAAA
>probe:Drosophila_2:1637713_at:166:651; Interrogation_Position=1158; Antisense; TCAAATACGGCTTTGGAGCTCCCTA
>probe:Drosophila_2:1637713_at:156:543; Interrogation_Position=1172; Antisense; GGAGCTCCCTACACTAATTACTATG
>probe:Drosophila_2:1637713_at:451:41; Interrogation_Position=1239; Antisense; ATCGGATGGCCACCTTTATGTTTTA
>probe:Drosophila_2:1637713_at:240:59; Interrogation_Position=1269; Antisense; ATGATGCTCCTTACGGAGGTGCCAC
>probe:Drosophila_2:1637713_at:513:561; Interrogation_Position=1334; Antisense; GGAAAAGTTCTGTTCTGGTACAATC
>probe:Drosophila_2:1637713_at:278:707; Interrogation_Position=1359; Antisense; TTAATGGCGACACCCACGACATGGA
>probe:Drosophila_2:1637713_at:288:507; Interrogation_Position=1406; Antisense; TGTCCCGTCTTTCATGGTTCCAAAT
>probe:Drosophila_2:1637713_at:288:55; Interrogation_Position=1436; Antisense; ATGACAGCCTGGATACACGAATATG
>probe:Drosophila_2:1637713_at:300:459; Interrogation_Position=1465; Antisense; GATTTTCATTCAACCCATATACCGC
>probe:Drosophila_2:1637713_at:263:149; Interrogation_Position=1545; Antisense; ACAGACGTTTTATTTCATTGGGAAG
>probe:Drosophila_2:1637713_at:88:369; Interrogation_Position=1614; Antisense; GAATGTGCAGCGCATAATACCTTTT

Paste this into a BLAST search page for me
AGGCAAGGAGCAGTTACCGCACACCGACCACTTTTGGATAGCTTGACTCAATGCGGGATATCACTGGCCTACAAATCAAATACGGCTTTGGAGCTCCCTAGGAGCTCCCTACACTAATTACTATGATCGGATGGCCACCTTTATGTTTTAATGATGCTCCTTACGGAGGTGCCACGGAAAAGTTCTGTTCTGGTACAATCTTAATGGCGACACCCACGACATGGATGTCCCGTCTTTCATGGTTCCAAATATGACAGCCTGGATACACGAATATGGATTTTCATTCAACCCATATACCGCACAGACGTTTTATTTCATTGGGAAGGAATGTGCAGCGCATAATACCTTTT

Full Affymetrix probeset data:

Annotations for 1637713_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720